You know that 4 movie tickets in Virginia plus 5 movie tickets in Maryland cost $77. You also know that 8 movie tickets in Virginia plus 3 movie tickets in Maryland cost $91. How much does a ticket in Virginia cost?

Answers

Answer 1

The cost of one ticket in Virginia is $8

What is a system of linear equations?

A System of Linear Equations is when we have two or more linear equations working together.

Given that, 4 movie tickets in Virginia plus 5 movie tickets in Maryland cost $77, Also know that 8 movie tickets in Virginia plus 3 movie tickets in Maryland cost $91.

To find the cost of a ticket in Virginia we will establish a system of linear equations and then solve them,

Let V represents the cost in Virginia that of in Maryland be M

Therefore,

4v+5m = 77.......(i)

8v+3m = 91........(ii)

Multiplying the equation eq(i) by 2 and subtracting eq(ii) from eq(i) [Elimination]

(8v+10m = 154)  - (8v+3m = 91)

7m = 63

m = 9

Put m = 9 in eq(i)

4v+5(9) = 77

4v = 77-45

4v = 32

v = 8

Hence, Each ticket in Virginia and Maryland costs $8 and $9 respectively.

For more references on system of Linear Equations, click;

https://brainly.com/question/19549073

#SPJ1


Related Questions

What is 3 8 equivalent to as a fraction?

Answers

Answer:

6/16

Step-by-step explanation:

Answer:

Step-by-step explanation:

15/40 i think

Write 6789 correct to 3 significant figures

Answers

Answer:

The answer is 679

Step-by-step explanation:

A significant figure is a number greater than zero so to 3 significant figures just count 3 from the front then round up 9 and it becomes 1 then add it to 8 to become 9 which equals 679

Hope it helps

Pls rate as brainliest answer

Part A: Maci made $170 grooming dogs one day with her mobile dog grooming business. She charges $60 per appointment and earned $50 in tips. Write an equation to represent this situation. (4 points)


Part B: Logan made a profit of $210. 00 as a mobile groomer. He charged $75. 00 per appointment and received $35. 00 in tips, but also had to pay a rental fee for the truck at $10. 00 per appointment. Write an equation to represent this situation. (4 points)


Part C: Explain how the equations from Part A and Part B differ. (2 points)

Answers

The equations for parts A and B are 170 = 60x + 50 and 210 = 75x + 35 - 10x, respectively.

What is an equation ?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

We have LHS = RHS (left hand side = right hand side) in every mathematical equation.

To determine the value of an unknown variable that represents an unknown quantity, equations can be solved.

The statement is not an equation if there is no "equal to" sign in it.

According to our question-

A) It is stated that Maci once earned $170 by grooming dogs.

For each appointment, she charges $60, and she received $50 in tips. Consequently, the equation to illustrate this is;

170 = 60x + 50

the number of appointments is x.

B) Logan earned $210.00 in profit. He charged $75.00 for each session and got $35.00 in gratuities. In addition, he had a $10.00 truck rental fee per appointment. In order to represent this, the equation is;

210 = 75x + 35 - 10x

the number of appointments is x.

C) The quantity of tips they will receive even without an appointment varies between the formulae.

learn more about equation click here:

brainly.com/question/2972832

#SPJ4

Name a pair of vertical angles and a pair of adjacent angles in each figure.

Answers

On solving the provided question we cans ay thatVertical Angles: TZU, XZW Adjacent Angles: TZU, UZV are Vertical angle and adjacent angle.

What is Vertical angle and adjacent angle,?

Vertical angles are two angles that share the same vertex and are formed by two intersecting lines. They are congruent (i.e. have the same measure) and are opposite each other

Adjacent angles are two angles that share a common vertex and side, but do not overlap. They are also called "next to" or "sharing an arm" angles.

Fig 1:

Vertical Angles: NMJ, LMK

Adjacent Angles: NMJ, JMK

Fig 2:

Vertical Angles: DEA, CEB

Adjacent Angles: DEA, AEB

Fig 3:

Vertical Angles: LQM, PQN

Adjacent Angles: LQM, MQN

Fig 4:

Vertical Angles: TZU, XZW

Adjacent Angles: TZU, UZV

To know more about Vertical angle and adjacent angle,Visit

brainly.com/question/8552615

#SPJ1

Rob collects model planes one of his planes uses a sacks in which 1 inch represents 1. 5 feet if the length of the model airplane is 12 inches find the length of the actual airplane on feet

Answers

If 1 inch represents 1.5 feet, we can use this conversion factor to find the length of the actual airplane in feet. Thus 12 inches of model airplane represents an actual length of the actual airplane of 18 feet.

Therefore the answer is 18 feet.

To convert the length of the model airplane (12 inches) to feet, we can multiply it by the conversion factor (1 inch = 1.5 feet)

= 12 inches × 1.5 feet/inch

= 18 feet

So the length of the actual airplane is 18 feet.

It is important to pay attention to the units of measurement when performing conversions and make sure to use the correct conversion factor. And also it's a good practice to always check your answer to make sure it makes sense in the context of the problem.

To know more on unit conversion

https://brainly.com/question/10983660

#SPJ4

what is the measure indicated in the parallelogram ​

Answers

Answer:

? = 74°

Step-by-step explanation:

• in a parallelogram, consecutive angles sum to 180° , that is

? + 106° = 180° ( subtract 106° from both sides )

? ( ∠ G ) = 74°

A local health club offers two membership plans. Under Plan A, you pa
flat rate of $201 a month and you get unlimited visits. Under Plan B, yo
pay only $33 per month, but must pay $8 for each visit to the club. At
what number of visits will both plans be the same?
The plans cost the same if you visit
times.

Answers

Therefore , the solution of the given problem of linear equation comes out to be the plan will be equal at 21 visits.

A linear equation is precisely what?

The algebraic equation y=mx+b stands in for a linear equation. The slope is m, and B is the y-intercept. The last phrase referred to a "simple formula with two elements" where both y and x are variables. Bivariate linear equations are calculations involving two variables. Here are a few examples: The outcomes are 2x - 3 = 0; 2y = 8; m + 1 = 0; x/2 = 3; x + y = 2; and 3x - y + z = 3. If the answer to a mathematical equation is in the form y=mx+b, where m denotes the slope and b the y-intercept, the equation is said to be linear.

Here,

Given :

Case 1: flat rate of $201 a month and you get unlimited visits.

and

Case 2:pay only $33 per month, but must pay $8 for each visit to the club.

Thus,

To find at what number of visits both plan be equal is

Let x be the number of visit,

We get,

Case 1: 201

Case 2: 33 + 8x

For equlaity:

=>33+ 8x =201

=>8x =168

=> x =168/8

=> x =21

Therefore , the solution of the given problem of linear equation comes out to be the plan will be equal at 21 visits.

To know more about linear equation visit:

https://brainly.com/question/11897796

#SPJ1

help? anyone? please

Answers

Answer:

Step-by-step explanation:

Perimeter is the addition of all the sides.

So in this question, if you add up all the sides :

14x + 8x +7x +12

Simplify by adding all terms with x :

29x + 12  

(As you can not add a number constant to a variable )

A research company desires to know the mean consumption of meat per week among males over age 27. They believe that the meat consumption has a mean of 4.7
pounds, and want to construct a 98 % confidence interval with a maximum error of 0.09 pounds. Assuming a variance of 1 pounds, what is the minimum number of
males over age 27 they must include in their sample? Round your answer up to the next integer.

Answers

Answer:

To construct a 98% confidence interval with a maximum error of 0.09 pounds and assuming a variance of 1 pound, the minimum sample size can be calculated using the formula:

n = (2 * standard error of the mean / margin of error)^2

Plugging in the values, we get:

n = (2 * (1 / sqrt(n)) / 0.09)^2

Solving for n, we get n = 832.6. Rounding up to the next integer, the minimum number of males over age 27 they must include in their sample is 833.

Step-by-step explanation:

Simplify: [tex]\frac{-28cd^3}{-21bd^2}[/tex]

Answers

The answer is 4cd/3b

hope it's correct

Evaluate the expression 5(x – 6 + 3x)2 – 6 where x = 2.

Answers:

1: 974

2: 14

3: -16

4: 26

Answers

So the expression evaluates to 14 when x = 2.

To evaluate the expression, we first substitute x = 2 into the expression:

5(2 - 6 + 3*2)^2 - 6

There are two methods for solving simultaneous linear equations: graphical methods and algebraic methods. The algebraic technique includes the substitution method as one of its categories.

The value of one variable from one equation is substituted in the second equation using the substitution method. In this manner, a pair of linear equations is reduced into a single linear equation with only one variable, which can then be solved quickly.

Next, we simplify the expression inside the parentheses:

=5(2 - 6 + 6)^2 - 6

=5(2)^2 - 6

=5*4 - 6

=20 - 6

=14

So the expression evaluates to 14 when x = 2.

To learn more about Algebra

visit; brainly.com/question/24875240

#SPJ4

Write and solve the inequality that represents negative one third is greater than or equal to the product of negative two fifths and a number.

negative one third is greater than or equal to negative two fifths y where y is greater than or equal to negative five sixths
negative one third is greater than or equal to negative two fifths y where y is greater than or equal to five sixths
negative two fifths is greater than or equal to negative one third y where y is less than or equal to negative two fifteenths
negative two fifths is less than or equal to negative one third y where y is greater than or equal to two fifteenths

Answers

The inequality that represents negative one third is greater than or equal to the product of negative two fifths and a number is: B. negative one third is greater than or equal to negative two fifths y where y is greater than or equal to five sixths.

What is an inequality?

In Mathematics, an inequality simply refers to a mathematical relation that can be used to compare two (2) or more numerical values, numbers, and variables in an algebraic equation, especially based on any of the following inequality symbols:

Greater than (>).Less than (<).Greater than or equal to (≥).Less than or equal to (≤).

Note: Let the variable y represent the unknown number.

Next, we would translate the word problem "negative one third is greater than or equal to the product of negative two fifths and a number" into an algebraic inequality as follows;

-1/3 ≥ -2/5 × y

-1/3 ≥ -2y/5

Multiplying both sides of the algebraic inequality by -5/2, we have:

-1/3 × -5/2 ≥ -2y/5 × -5/2

5/6 ≤ y

y ≥ 5/6.

Read more on inequality here: https://brainly.com/question/28722137

#SPJ1

12x - 2/3 = 83 1/3
Can you please help me solve to find X?

Answers

let's firstly convert the mixed fraction to an improper fraction, and then let's multiply both sides by the LCD of all denominators

[tex]\stackrel{mixed}{83\frac{1}{3}}\implies \cfrac{83\cdot 3+1}{3}\implies \stackrel{improper}{\cfrac{250}{3}} \\\\[-0.35em] ~\dotfill\\\\ 12x-\cfrac{2}{3}=\cfrac{250}{3}\implies \stackrel{\textit{multiplying both sides by }\stackrel{LCD}{3}}{3\left( 12x-\cfrac{2}{3} \right)=3\left( \cfrac{250}{3} \right)}\implies 36x-2=250 \\\\\\ 36x=252\implies x=\cfrac{252}{36}\implies x=7[/tex]

Is 9x² 30x 25 a perfect square trinomial?

Answers

Yes, [tex]9x^2-30x +25[/tex]  is a perfect square trinomial.

How can you tell if a trinomial is a perfect square?

A perfect square trinomial expression can be created by taking the binomial equation's square. If and only if a trinomial of the form [tex]ax^2 + bx + c[/tex] meets the requirement [tex]b^2 = 4ac[/tex], it is said to be a perfect square.

What trinomial has a perfect square?

Two of your terms will be perfect squares in a perfect square trinomial. This trinomial is not a perfect square trinomial if it lacks two perfect square terms. The square root of each perfect square word should now be determined, combine the two square roots, then multiply the result by two.

This trinomial is a perfect square. The only thing left to determine is whether the middle term matches when you square (3x-5) because both [tex]9x^2=(3x)^2\ and\ 25=52[/tex] are perfect squares. The minus sign was used to at least produce a negative coefficient for the middle term.

To learn more about perfect square trinomial visit the link:

https://brainly.com/question/28967424

#SPJ1

Is log e and log same?

Answers

The log function with base 10 is called the “common logarithmic functions” and the log with base e is called the “natural logarithmic function”. The logarithmic function is defined by, if logab = x, then ax = b.

The log with a base "e" (log e) is the same thing as In

The natural logarithmic function log e  refers to its logarithmic function of the base of the constant e. For this equation to be equivalent in logarithm;

We can say that:

log e = ln

Logarithm may alternatively be defined as the exponent power to which a base must be raised in order to produce a given number.

Learn more about Logarithm here:

https://brainly.com/question/28596588

#SPJ4

An entertainment center is 52 inches wide and 40 inches high. Will a tv with a 60 inches diagonal fit ?

Answers

No, a TV with a 60 inch diagonal would not fit in an entertainment center that is 52 inches wide and 40 inches high.

What is diagonal?

Diagonal is a line connecting two or more points that are not in a straight line. It is used to describe the shape of a polygon and also used in mathematics to refer to lines, angles, and shapes. It can also refer to a line, or direction, that is not parallel or perpendicular to something else. In geometry, diagonal lines are used to divide shapes into equal parts, and are used in the construction of polygons. In linear algebra, diagonal lines are used to calculate the determinant of a matrix.

The diagonal measurement of a TV is the length of a line drawn between the opposite corners of the TV. For a 60 inch diagonal TV, the width of the TV would be around 52 inches and the height would be around 33 inches. As the entertainment center is only 40 inches high, the TV would not fit in it.

To learn more about diagonal
https://brainly.com/question/27991573
#SPJ1

The two expressions below have the same value when rounded to the nearest hundredth
log5b log948
what is the approximate value of logb to the nearest hundredth

0.93
1.23
9.16
65.53

Answers

The approximate value of ㏒(b) to the nearest hundredth is 1.23.

Logarithms:

The other method to write exponents in mathematics is using logarithms. A number's base-based logarithm is equal to some other number. A logarithm performs exponentiation's exact opposite function. 

In Logarithms, ㏒ₐ(b) = ㏒(b)/ ㏒(a)

Given that

The two expressions below have the same value when rounded to the nearest hundredth

=> ㏒₅ (b) = ㏒₉ (48)  

As we know  ㏒ₐ(b) = ㏒(b)/ ㏒(a)

=> ㏒₅ (b) = ㏒(b)/㏒(5)

=> ㏒(b)/㏒(5) = ㏒₉ (48)  

=> ㏒(b) = ㏒₉ (48) ㏒(5)

=> ㏒(b) =  (1.7618)(0.6989)  

=> ㏒(b) = 1.23132202  

=> ㏒(b) = 1.23  

Therefore,

The approximate value of ㏒(b) to the nearest hundredth is 1.23.

Learn more about Logarithm problems at

https://brainly.com/question/30085872

#SPJ1

It says its wrong. I do not know how to mark you the brainliest

Answers

Answer:

A) Angle 2, Angle M

B) Angle M

C) Angle NM (or MN), Angle QM (or MQ)

Step-by-step explanation:

A) So M is the vertex of angle QMP, and the picture tells you that it's angle 2

B) M is the middle angle

C) The diagram shows you the answer

When you see a graphed cluster of dots depicting the values and relationship of two different variables, you are seeing a visual description of relatedness called a
histogram
standard deviation distribution
percentile distribution
bar graph
scatter-plot or scatter-gram

Answers

When you see a graphed cluster of dots depicting the values and relationship of two different variables, you are seeing a visual description of relatedness called a scatter-plot or scatter-gram.

What is scatter-plot or scatter-gram?

Scatter-plot: A scatter-plot is a form of mathematical diagram or plot that employs Cartesian coordinates to illustrate distinct values associated to two variables for a specific set of data. It is also known as a scatter-gram, scatter-graph, scatter-chatter, or scatter-diagram.

It is being utilized to determine how one variable influences the other.

The supplied statement in the question above represents the scatter plot.

Here,

When you observe a graphed cluster of dots reflecting the values and relationship of two separate variables, you are looking at a scatter-plot or scatter-gram, which is a visual explanation of relatedness.

To know more about scatter-plot or scatter-gram,

https://brainly.com/question/14529604

#SPJ4

Step 3: Testing Jerome’s sister’s approach
Jerome’s sister told him to multiply both the amount of water and the amount of drink mix by the same number to keep the ratio of water to drink mix the same and still increase the total amount of energy drink.
Complete the table below.







Is Jerome’s sister correct? Explain why or why not, using examples from the ratio table to support your argument.

Answers

Yes Jerome's sister is correct.

The answer to the table is given below.

What is a ratio?

The quantitative relation between two amounts shows the number of times one value contains or is contained within the other. for example-"the ratio of computers to students is now 2 to 1"

Given here:

Jerome’s sister told him to multiply both the amount of water and the amount of drink mix by the same number to keep the ratio of water to drink mix the same and still increase the total amount of energy drink.

Drink mix     3  6    9   12   15

water cups   8  16   24  32  40 

we know this is true because to find a ratio equivalent to another we have to multiply the two quantities, by the same number.

Hence, The complete table is shown above.

Learn more about ratios here:

https://brainly.com/question/13419413

#SPJ1

Triangle STU is a right triangle.
Write an equation that relates the lengths of sides s, t, and u? (5 points)

Answers

Therefore , the solution of the given problem of triangle comes out to be the relationship between s,t and u is u²= t²+s².

What is the triangle?

Given that it has three sides and three vertices, a triangle qualifies as a polygon. It is a fundamental geometric figure. Triangle ABC is the term used to refer to a triangle containing the vertices A, B, and C. When the three points are not collinear, a unique plane and triangle in Euclidean geometry are discovered. Triangles are polygons because they have three sides and three corners. The points where the three sides of the triangle converge are referred to as the triangle's corners. Three triangle angles are multiplied to yield 180 degrees.

Here,

Given : Triangle STU is a right triangle.

Thus,

We find :

sides s,t and u

the relationship between them is :

As it is a right triangle

So,

According to the pythagoras theorem,

=>u²= t²+s²

Therefore , the solution of the given problem of triangle comes out to be the relationship between s,t and u is u²= t²+s².

To know more about triangle visit:

https://brainly.com/question/2773823

#SPJ1

Can a/the variable in a algebraic expression be a base?

Answers

Answer:

yes

Step-by-step explanation:

yes

yes

yes

yes

yeyed

yes

CAN SOMEONE PLS HELP WITH THIS QUESTION ILL GIVE 20 POINTS​

Answers

To fix their problem, a consumer is requesting a phone call,... I'll get a notification as soon as you respond.

How high is the ball after one second?

The ball's height is 86 feet after one second. h=176t-16t2 calculates the height of a ball in feet after t seconds.

How much time did the ball take to hit the ground When the ball lands, its height (h) is 0 feet. You launch a ball into the air with an initial vertical velocity of 32 feet per second while standing at a height of 5 feet.

Calculate the maximum height of the ball using the vertical motion model, which is h = -16t2 + vt + s, where v is the initial velocity in feet/second and s is the height in feet.

To learn more about vertical motion model refer to:

https://brainly.com/question/28446508

#SPJ1

Issa jogged two-thirds of the way home from school. Then he was tired, so he walked the remaining 3{,}200\text{ m}3,200 m3, comma, 200, start text, space, m, end text. how many kilometers did issa travel from school to his house

Answers

The distance Issa travelled from school to his house is 9.6 km.

What is the distance travelled?

The actual length covered by the body is defined as distance travelled, whereas displacement is the straight path between the initial and final points.

Here,

Let the total distance between school and home be 'x' meters.

Issa jogged two-thirds of x = 2x/3

So the total distance between school and home is = 2x/3 + 3200

However, the total distance from school to home = x

= 2x/3 + 3200 = x

= 3200 = x/3

= 9600 = x

As a result, the total distance from school to home is 9600 meters.

We're now converting it to kilometers.

We know that 1000 meters equals one kilometer.

9600 meters = 1/1000 x 9600

= 9.6 kilometers

Therefore the distance travelled will be 9.6 km.

To learn more about distance refer to :

brainly.com/question/24283318

#SPJ4

what is an equation of the line that passes through the point (8,-7) and is parallel to the line 5x+4y=16

Answers

keeping in mind that parallel lines have exactly the same slope, let's check for the slope of the equation above

[tex]5x+4y=16\implies 4y=-5x+16\implies y=\cfrac{-5x+16}{4} \\\\\\ y=\stackrel{\stackrel{m}{\downarrow }}{-\cfrac{5}{4}}x+4\qquad \impliedby \begin{array}{|c|ll} \cline{1-1} slope-intercept~form\\ \cline{1-1} \\ y=\underset{y-intercept}{\stackrel{slope\qquad }{\stackrel{\downarrow }{m}x+\underset{\uparrow }{b}}} \\\\ \cline{1-1} \end{array}[/tex]

so we're really looking for the equation of a line whose slope is -5/4 and it passes through (8 , -7)

[tex](\stackrel{x_1}{8}~,~\stackrel{y_1}{-7})\hspace{10em} \stackrel{slope}{m} ~=~ - \cfrac{5}{4} \\\\\\ \begin{array}{|c|ll} \cline{1-1} \textit{point-slope form}\\ \cline{1-1} \\ y-y_1=m(x-x_1) \\\\ \cline{1-1} \end{array}\implies y-\stackrel{y_1}{(-7)}=\stackrel{m}{- \cfrac{5}{4}}(x-\stackrel{x_1}{8}) \implies y +7= -\cfrac{5}{4} (x -8) \\\\\\ y+7=-\cfrac{5}{4}x+10\implies {\Large \begin{array}{llll} y=-\cfrac{5}{4}x+3 \end{array}}[/tex]

What are the domain and range of this function

(0, -4)
(10,-2)
(-10, -2)
(1, -6)

Answers

The graph indicates that the line segment's domain and range are [-5, 1] and [-4, 7, respectively.

what is domain?

The range of values a function may accept is referred to as its domain. These numbers represent the x-values of a function like f. (x). The range of values that a function may operate on is referred to as its domain. The value that the function returns following the insertion of the x value is this set. A function containing the independent variable x and the dependent variable y is said to be y = f(x). A value of x is said to be in the domain of a function f if it can be used to successfully create a single value y utilizing the value of x for that purpose.

The range refers to all potential values of y, while the domain refers to all conceivable values of x.

The graph indicates that the line segment's domain and range are [-5, 1] and [-4, 7, respectively.

To know more about domain visit:

https://brainly.com/question/28135761

#SPJ1

what is the value of x?

Answers

Answer:119

Step-by-step explanation:

because it's on oppisite sides on the outside

Answer:

C) 119°

------------------------------

The two given two angles are alternate exterior angles and therefore  congruent according to alternate exterior angles theorem:

x = 119°

Definition:

Alternate exterior angles are the pair of angles that are formed on the outer side of the parallel lines but on the opposite side of the transversal.

a dealer sold printing machine for 47460 including 13% vat. find the original price(excluding vat).

Answers

Answer:

42000

Step-by-step explanation:

Original price (before VAT) is 100% of price.

VAT is 13%, of the original price so final price is 113% of original price.

113% = 1.13

original price = 47460/1.13 = 42000

What is 3 6 equivalent to in fractions?

Answers

Answer:

1/2

Step-by-step explanation:

Lionel purchases 1-pound bags of each of the five seeds and nuts shown in the table. Of the following, which best approximates the average (arithmetic mean) number of calories per bag?
(1 pound = 16 ounces)
A)150
(B)250
C) 1,500
D) 2,500

Answers

The best approximate average (arithmetic mean) number of calories per bag is equal to: D) 2,500.

What is an arithmetic average?

In Mathematics, an arithmetic average is sometimes referred to as arithmetic mean and it can be defined as a ratio of the sum of the total number in a data set (population) to the frequency of the data set.

How to calculate the arithmetic average for the number of calories per bag?

Mathematically, the arithmetic average for the number of calories per bag can be calculated by using the following formula:

Arithmetic average = [F(x)]/n

Next, we would determine the total number of calories and then convert to ounces:

Total number of calories, F(x) = 198 + 80 + 159 + 166 + 185

Total number of calories, F(x) = 788 calories.

Note: 1 pound = 16 ounces.

Total number of calories, F(x) = 788 calories × 16 ounces

Total number of calories, F(x) = 12,608 calories.

Now, we can calculate the arithmetic average for the number of calories per bag:

Arithmetic average = [F(x)]/n

Arithmetic average = 12,608/5

Arithmetic average = 2,521.6 ≈ 2,500.

Read more on mean here: brainly.com/question/9550536

#SPJ1

Other Questions
f(n) = 2n-1 find the arithmetic sequence ? Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day.