Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

Answer 1

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1


Related Questions

PLEASE ANSWER QUICK Have you heard the terms structure and function used before? Using what you already know, identify two structures in your classroom and state their function

Answers

Yes, I have heard the terms structure and function used before. The two structures I identified in my classroom were:

Desk - The desk provides a stable, elevated surface for students to use for writing and studying.Chalkboard - The chalkboard provides a surface for teachers to write notes, instructions, and reminders.

The Importance of Structures in the Classroom

In the modern classroom, structures are essential for an effective learning environment. Structures provide the necessary framework for students to work and learn, while also providing teachers the necessary tools to facilitate learning. Without the right structures in place, learning quickly becomes difficult and inefficient.

Desks are some of the most crucial structures in a classroom. A student's desk provides them with a stable, elevated surface to write and study on. Having a desk allows students to spread out their materials and have easy access to them whenever they need them. It also gives them a designated workspace to stay focused and organized.

Learn more about Structures in the Classroom:

https://brainly.com/question/2108834

#SPJ4

What is the genotypic ratio of dihybrid cross of round yellow?

Answers

The genotypic ratio of dihybrid cross of round yellow is 9:3:3:1 .

Mendel noticed that his dihybrid cross' F2 offspring had a 9:3:3:1 ratio and produced nine plants with round, yellow seeds, three plants with round, green seeds, three plants with wrinkled, yellow seeds, and one plant with wrinkled, green seeds.

An organism's genotype is made up of all of its genetic components. [1] The term "genotype" can also be used to describe the alleles or genetic variations that a person carries in a certain gene or genetic region. [2] The ploidy, or number of copies of each chromosome, found in that species, determines how many alleles a person can have for a given gene.

To learn more Genotype :

https://brainly.com/question/22117

#SPJ4

A researcher discovers a mysterious unknown multicellular eukaryotic organism. She would be confident that it is an animal if she observed that it ____

Answers

A researcher discovers a mysterious unknown multicellular eukaryotic organism. She would be confident that it is an animal if she observed that it has specialized organs, such as eyes, ears, or a heart, or if it moved in response to its environment.

Animals are a distinct group of multicellular eukaryotes, and they are characterized by the presence of specialized organs that aid in the collection of energy and nutrients, as well as providing a means for locomotion. These organs can be as simple as a single cell like the cilium on a paramecium, or as complex as the human brain. Additionally, animals usually respond to their environment in some way, such as locomotion or behavioral responses.

The researcher's observation of specialized organs and movement in response to its environment would be a strong indication that the organism is an animal. By looking at the size, shape, and organization of the cells under a microscope, the researcher could further confirm the identity of the organism. For instance, the presence of cilia or flagella would suggest that the organism is a protozoan, while the presence of an organized nervous system could indicate that it is a more complex organism, such as an arthropod or a vertebrate.

Learn more about multicellular eukaryotic organism at : https://brainly.com/question/13386606

#SPJ4

__________ is a slow, idioventricular rhythm with wide QRS complexes that are representative of escape beats that originate from a lower focus in the ventricles. Asystole

Answers

Answer:

Ventricular tachycardia is a slow, idioventricular rhythm with wide QRS complexes that are representative of escape beats that originate from a lower focus in the ventricles. Asystole

in details the steps for blood clotting in response to an injury

Answers

The process of blood clotting, also known as coagulation, is a complex series of steps that the body undergoes in response to an injury in order to stop bleeding and begin the process of healing. Here are the steps involved in blood clotting:

Vasoconstriction: When an injury occurs, the blood vessels in the affected area constrict, or narrow, to decrease blood flow and reduce bleeding.
Platelet activation: Platelets, which are small, disk-shaped cells found in the blood, become activated and begin to stick to the walls of the damaged blood vessels.
Platelet aggregation: Activated platelets release chemicals that attract more platelets to the site of the injury. These platelets then stick together, or aggregate, to form a plug that helps to stop the bleeding.
Formation of the fibrin mesh: The activated platelets release chemicals that stimulate the production of a protein called fibrin. Fibrin forms a mesh-like structure that helps to hold the platelet plug in place and strengthen the blood clot.
Blood clotting: The combination of the platelet plug and the fibrin mesh forms a blood clot that seals off the damaged blood vessel and stops the bleeding. Clot retraction: Once the blood clot has formed, the platelets in the clot contract, or shrink, to help pull the edges of the damaged blood vessel together and further seal the wound.
Clot dissolution: After the injury has healed, the body begins to dissolve the blood clot. This is done through the action of enzymes called plasminogen activators, which break down the fibrin in the clot.

Where is ATP made in respiration?

Answers

The majority of ATP synthesis takes place within the mitochondrial matrix during cellular respiration, with each molecule of glucose oxidized creating around 32 A T P molecules.

ATP produced in mitochondria serves as the main energy source for vital biological functions such muscle contraction, nerve impulse transmission, and protein synthesis. The majority of the ATP produced during cellular respiration is created in the mitochondrial matrix, where each glucose molecule that is oxidised yields roughly 32 molecules of ATP.

Gradients are produced as a result of protons being pumped out of the matrix as electrons move down the chain and release energy in the process.

Protons flow back into the matrix and are converted into ATP by an enzyme called ATP synthase.

The inner mitochondrial membrane contains ETS.

The majority of the ATP in cells is produced by the enzyme ATP synthase, which does this by converting ADP and phosphate to ATP. ATP synthase is found in the membrane of mitochondria, which are cellular organelles; in plant cells.

For such more questions on Respiration:

brainly.com/question/18024346

#SPJ4

How many chromatids are there after meiosis 2?

Answers

Answer:

Try 2 sister chromatids.

Explanation:

In the evolution of life on Earth, which one of the following traits must have evolved last (meaning most recently): O sexual reproduction; centromeres associated with DNA; O self-defense mechanisms; multicellularity; O locomotion; mitosis.

Answers

Pertaining to sexual reproduction. DNA mitosis, self-defense mechanisms, and multicellularity are all associated with centromeres.

What precisely is reproduction?

The process of creating offspring is called reproduction. The two basic types of reproduction are sexual and asexual. An creature that reproduces sexually is extremely varied and carries the genetic material of its two grandparents. Asexual reproduction, which involves each parent reproducing themselves, results in children that are genetically identical.

Explain it the action of procreating?

The process of creating new members of same species is called reproduction. An organism has two ways of reproducing: asexually and sexually. Merging both male and female gametes is not considered an instance of asexual reproduction. Bacteria, amoebas, and other amoeba exhibit this.

To know more about reproduction visit :

brainly.com/question/7464705

#SPJ4

How do oxygen and carbon dioxide play different roles in the ocean?

Answers

In the ocean, For respiration, marine organisms use oxygen, which converts carbohydrates into energy and produces carbon dioxide and water as byproducts.

For marine life, dissolved oxygen and carbon dioxide are essential. Through the process of photosynthesis, marine plants utilize dissolved carbon dioxide, sunlight, and water to produce carbohydrates. The water gets oxygen from this process. All marine organisms respire with oxygen, which breaks down carbohydrates into energy and produces carbon dioxide and water as byproducts. These organs are utilized by fish and other marine animals with gills to extract oxygen from seawater.

Know more about photosynthesis here: https://brainly.com/question/29764662

#SPJ4

What is the strongest evidence to support the theory of evolution?

Answers

Perhaps the strongest fossil evidence for evolution is the continuity of the fossil record from prehistoric to modern times.

The Devonian, the age of the fishes, or human fossils amid dinosaur remains are not things we discover anyplace on Earth. The five assumptions that Darwin combined are evolution, or common descent, gradualism, species diversity, and natural selection. A theory is a reason for how a natural phenomena works that has been put to the test extensively through observations and tests meant to prove the correctness of the explanation. In this situation, evolution may be viewed as a theory as well as reality. It cannot be disputed that throughout Earth's history, living things have changed or evolved.

Learn more about Evolution here:

https://brainly.com/question/6111443

#SPJ4

What do you think is the importance of food labels with nutrition?

Answers

Explanation:

It's importance is stating the nutritional value of the product and letting consumers know about any possible allergens

Which two statements describe forces that move water within the global
ocean conveyor belt?
A. Upwelling causes cold water to separate and sink below warmer
water.
B. Saltwater freezes, leaving behind warmer freshwater that flows
faster.
C. Water freezes, causing the saltier and denser remaining liquid
water to sink.
D. Wind pushes surface water away from shore, and cold water rises
to replace it.

Answers

The correct answer is C

or
Scientists theorize that all life started with simple prokaryotic organisms. New species continue to evolve
from existing species, creating the variety of life we see today. The following diagram shows the basic
process.
fungi
(oukaryotic,
unicellular,
multicellular)
protista
(eukaryotic,
uni-or
multicellular)
eubacteria
(prokaryotic,
unicellular)
animalia
(eukaryotic
multicellular)
universal
ancestor
plantae
(eukaryotic
multicellular)
archaebacteria
(prokaryotic,
unicellular)
Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary
relationship than organisms that share only the same phylum? Explain your reasoning using the results of
your investigation.

Answers

According to the taxonomical categorization, organisms are grouped into phyla and classes according to how closely they resemble one another.

Plants, animals, microbes, and other organisms are all classified taxonomically. It organizes, categorizes, and gives organisms scientific names.

The phylum is the level above the order in taxonomy, and it will be less comparable to the organism in order or class.

In contrast to an organism belonging to the same phylum, an organism belonging to the same order will share a close evolutionary link.

What, using an example, is taxonomical classification?

Similar categories, including kingdom, phylum, class, order, family, genus, and species, are used to classify organisms. Species are groups of creatures that share a common trait. On the basis of the morphological characteristics, species are distinguished. For instance, many mango varieties are all members of the same species.

To learn more about taxonomical classification from given link

https://brainly.com/question/24262076

#SPJ1

Drag the labels to their appropriate locations to identify the type of point mutation shown. a) silent mutation b) nonsense mutation c) missense mutation

Answers

The type of point mutation shown: a) silent mutation

b) nonsense mutation

c) missense mutation

d) Frameshift mutation

Any change in the DNA sequence of a cell. Mutations can be caused by mistakes in cell division or by being exposed to DNA-damaging agents in the environment. Mutations can be harmful, beneficial, or inactive.

Hereditary mutations cause cystic fibrosis, hemophilia, and sickle cell disease. Other mutations can happen on their own during a person's life. These are known as sporadic, spontaneous, or new mutations. They only affect a small number of cells.

Genetic mutations are changes to your DNA sequence that occur during cell division, or when your cells multiply. Your body's DNA coding directs it on how to create and operate. Hereditary mutations can cause genetic disorders like cancer, or they might help people adapt to their surroundings over time.

learn more about  mutation  to visit this link

https://brainly.com/question/17130462

#SPJ4

Which phylogenetic tree highlights the most recent common ancestor of all animals with four limbs (where limbs include legs, arms, and wings)

Answers

It draws attention to the taxon, or most recent common ancestor, of all tetrapods. The tips and nodes of the tree, respectively, represent groups of descendant taxa and common ancestors of descendants.

The evolutionary connections of biological species are described by the phylogenetic tree, often called phylogeny. The branching pattern of the phylogenetic tree illustrates how a series of shared ancestors gave rise to diverse species or groupings.

The phylogenetic tree helps us understand a person's complete life history or life.

Follow each taxon's lineage back in time (toward the base of the tree) until all the lineages meet to identify the most recent common ancestor of a group of taxa. Their most recent shared ancestor is represented by that node.

Learn more about to phylogenetic

https://brainly.com/question/13577065

#SPJ4

The plasma membrane of E. coli is about 75% protein and 25% phospholipid by weight. How many molecules of membrane lipid are present for each molecule of membrane protein

Answers

The plasma membrane of E. coli is about 75% protein and 25% phospholipid by weight. 26 molecules of membrane lipid are present for each molecule of membrane protein

The plasma membrane (cell membrane) is responsible for protecting the cell and also offers a fixed cell environment.

The lipid to protein ratio is 1:4 (25% lipid and 75% proteins).

An average protein has a weight of 54,000 (5.4 x 104).

54,000/3 = 18,000.

So, 1:4 ratio = 18,000:54,000.

So, for a protein (54,000 weight), there are lipids weighing 18,000.

An average lipid weighs 700. So, 18,000 weight of lipids would have 25.71 (26) lipid molecules.

That means there are 26 lipid molecules are present for each molecule of membrane protein.

learn more about plasma membrane:

https://brainly.com/question/3699362

#SPJ4

Please help me with this!!

Answers

The answers to the table are genotype, phenotype, trait, heredity, chromosome, allele, in that sequence.

How does a chromosome explain work?

a component that can be found in a cell's nucleus. Proteins and DNA are arranged into genes on a chromosome. There are typically 23 pairs of chromosomes in each cell.

What is a chromosome's primary purpose?

DNA may be precisely duplicated during these cell divisions thanks to chromosomes. So, once more. Our cells' nuclei include chromosomes, which enable precise DNA duplication during cell division. This guarantees that our internal processes go smoothly and effectively.

To know more about chromosome visit:

brainly.com/question/1596925

#SPJ1

HURRY I NEED HELP PLEASE ​

Answers

At its typical boiling point of 100°C, water has a vaporizing heat of 2260Jg⁻¹. This indicates that for water to convert from 1 g of liquid at 100°C to 1 g of steam at 100°C, it must absorb 2260 J of temperature.

What is the name of environment?

An ecosystem, often known as the environment, is a natural system made up of all living things—plants, animals, and microbes—as well as all inanimate objects (abiotic components) that make up the environment.

Why is the environment so crucial?

The status of the environment has a direct impact on human health and wellbeing. Good natural settings provide our fundamental requirements by providing fresh water, clean air, and a hospitable climate for growing food.

To know more about Environment visit:

https://brainly.com/question/27350747

#SPJ1

1. What are the requirements for an area to be considered a hotspot?

A. 1,500 endemic plant species .

B. 30% or less of the endemic plant species remain.

C. Must be part of a developing country.

D. Both A and D

2. Where are some of the unique ecosystems of the United States?

A. In Pacific Northwest and California.

B. In the Florida Everglades and Hawaii.

C. Both A and B

D. None of the above .

3. If you are buying an exotic species at a pet store, why should you ask for documentation regarding the origin and legality before buying it ?

A. It could have diseases

B. It is illegal to capture/purchase some species under the law

C. In case you need to return it

D. There is no need to do this

Answers

The correct options are; 1. A. 1,500 endemic plant species.

2. C. Both A and B

3. B. It is illegal to capture/purchase some species under the law.

How important are biodiversity hotspots, and what are they?

Biodiversity hotspots are geographical areas that are ecologically distinct and have a particularly high species richness; they are therefore top priorities for nature preservation. Biodiversity is defined in a variety of ways.

What environmental effects does the trade in exotic pets cause?

When foreign species are removed from the wild, they are in fact eliminated from the local, reproducing population. When released by their owners into a continent other than their own, exotic animals can also devastate the ecosystem.

To know more about Biodiversity hotspots visit

https://brainly.com/question/28148301

#SPJ1

The respiratory system delivers clean, moist air into close contact with the blood. How is the system structured to accomplish this efficiently

Answers

The respiratory system is structured to efficiently deliver clean, moist air into close contact with the blood with the help of alveoli.

Alveoli are tiny air sacs that are found at the ends of bronchioles, and they are responsible for the gas exchange that occurs between the air and the blood. They increase the total surface area and contact between the air we breathe and the blood. Their presence is important for the efficiency of the respiratory system.

The system is also designed to filter and remove any foreign particles present in the inhaled air. This is done through the presence of cilia, mucus, and other mechanisms that help keep the airways clean, the humidification of the air, and the warmth of the air.

Learn more about respiratory system:

https://brainly.com/question/3305440

Some seeds are light and can easily be carried long distances by the wind. Some seeds have barbs that cause them to attach to the fur of animals. Some seeds are enclosed in fruit that is eaten by birds. What do these features of seeds all have in common?
A.
They all provide nourishment to the seed.
B.
They all help the seed survive winter.
C.
They all allow for seed dispersal.
D.
They all protect the seed from injury.

Answers

These features of seeds all have in common for They all allow for seed dispersal.

What is seed dispersal?Seed dispersal is the mechanism by which plant seeds are transported to new sites for germination and the establishment of new individuals. Animals commonly mediate this process, and consequently, the ultimate fate of seeds depends on their effectiveness as seed dispersersDispersal can be defined as the process by which individuals move from the immediate environment of their parents to establish in an area more or less distant from them.Dispersal is the spreading of things over a wide area. Plants have different mechanisms of dispersal for their spores. Synonyms: scattering, spread, distribution, dissemination More Synonyms of dispersalDispersal of seeds is very important for the survival of plant species. If plants grow too closely together, they have to compete for light, water and nutrients from the soil. Seed dispersal allows plants to spread out from a wide area and avoid competing with one another for the same resources

To learn more about seed dispersal refers to:

brainly.com/question/16113316

#SPJ1

Please help me with this!!

Answers

Genetic makeup is the combination of genes that make up an individual's unique genetic code.

1.The physical appearance of an individual's genetic makeup phenotype.

2. A particular characteristic of an individual trait.

3. The passage of genetic instructions from one generation to the next generation genotype.

4. One variation of a particular gene allele.

5. The specific genetic makeup of an individual chromosomes.

6. Contain the genes of an individual heritability.

What are Chromosomes?

Chromosomes are thread-like structures composed of DNA and proteins that carry genetic information. In most living organisms, each cell contains a pair of chromosomes, one inherited from each parent. Humans have 23 pairs of chromosomes in each cell, for a total of 46. Chromosomes are responsible for determining an organism's traits, from eye color to blood type.

To know more about Chromosomes,

https://brainly.com/question/11912112

#SPJ1

Indicate whether the glven act would create water retention or water loss In the body.
Dry mouth ~ Increased osmolarity of blood aldostorenone hyposecretion ~ Decreased renal tubular reabsorption of water Renin release ~ Hyponatremia
Increased blood pressure ~ Ingestion of water
ADH hypersecretion ~ Hyperkalemia
Increased water permeability of the DCT and collecting ducts of the kidneys ~ Hemorrhage
Exercise in a warm climate

Answers

ADH and testosterone increase the risk of heart and volume as the water is absorbed into the bloodstream into to the capillaries, bringing the blood salt concentration back to normal.

What does the renin enzyme do in response to a lower ph quilt in the kidney?

An enzyme known as renin is released by kidney cells in response to low blood pressure. The kidneys reabsorb salt due to renin. Water retention is a constant side effect of sodium reabsorption. Blood pressure and volume are restored as a result.

Which hormone promotes water retention while guarding against dehydration?

A deficiency of renin - angiotensin system (ADH), also known as prolactin, usually prevents hydration, or the kidneys and liver inability to react to ADH, are the two main causes of diabetes insipidus. The kidneys may hold onto the body's fluids thanks to ADH. The steroid.

To know more about ADH visit :

https://brainly.com/question/14326518

#SPJ4

Why is it important to abstain from sex before marriage?

Answers

Abstinence may be a strategy to do this until you're ready to prevent and/or handle the risks involved with sex, such as pregnancy and STDs.

Additionally, abstinence might help you focus on other important elements of your life, such as your friends, schoolwork, hobbies, sports team, social life, and future ambitions.

enable sexual activity between you and your partner be enjoyed without leading to pregnancy. Additionally, some types of outercourse (such dry humping or bare ) don't transmit STDs. increase in faithfulness and closeness between partners Prevent pregnancy if you don't have access to another method of birth control. make it simpler for you to understand your own body (and the body of your partner) help you comprehend it.

Learn more about premarital sex at

https://brainly.com/question/29370904?referrer=searchResults

#SPJ4

__________ are chemicals that enhance urinary output. nitrogenous wastes countercurrent exchangers diuretics countercurrent multipliers
A) secretagogues B) countercurrent multipliers C) countercurrent exchangers D) diuretics.

Answers

Diuretics are chemicals that enhance urinary output. nitrogenous wastes countercurrent exchangers diuretics countercurrent multipliers.

Diuretics, sometimes water pills and Removes salt (sodium) and water from the body called Most of these drugs help the kidneys release more sodium into the urine. Sodium aids in the removal of water from the blood, therefore decreasing the quantity of fluid moving through your veins and arteries.

The nitrogenous waste products excreted by the kidneys are urea and ammonia. Diuretics increase urine output from the kidneys (that is, they promote diuresis). It does this by changing the way your kidneys use sodium. As the kidneys excrete more sodium, they also excrete more water.Diuretics make you pee more often, so take them preferably in the morning.

For more information on Diuretics  , visit :

https://brainly.com/question/13020292

#SPJ4

What is the function of the repressor in the E. coli lac operon?
O A repressor is a type of DNA sequence which activates or inactivates the expression of the lac operon genes by acting as a protein binding site. O A repressor is a type of protein that inactivates the expression of the lac operon genes by binding to the DNA of the lac operon. O A repressor is a type of DNA sequence that is located outside the lac operon and expresses the protein that controls lactose gene expression. O A repressor is a type of DNA sequence that activates the expression of the lactose genes by acting as an RNA polymerase binding site for the lac operon.

Answers

Ded by a DNA sequence called as a repressor. A repressor is a DNA sequence that activates expression.

What is protein?

Explain protein. Protein makes up the majority of the body's organs, tissues, and body parts, include muscle, bones, skin, and fur. It helps to produce enzymes, which power countless chemical reactions, and hemoglobin, which carries oxygen in the blood.

What benefits does protein offer?

Protein is an essential part of the processes that give you energy and enable your blood to carry oxygen throughout your body. In addition, it encourages the creation of antibodies that fight off illnesses and infections, keeps

To know more about protein visit:

brainly.com/question/29776206

#SPJ4

Which of the following is not detected by chemoreceptors in the carotid and aortic bodies? Multiple Choice a. Oxygen b. Blood pressure c.pH d.Carbon dioxide e.Oxygen and carbon dioxide

Answers

B. Blood pressure

Blood pressure is not detected by chemoreceptors in the carotid and aortic bodies

The purpose of this experiment is to separate the pigments to identify each pigment by their color properties and how far they travel using paper chromatography.

Answers

The purpose of this experiment is to separate the pigments to identify each pigment by their color properties and how far they travel using paper chromatography is the goal of the experiment separation of pigments by paper chromatography.

Paper chromatography is a separation method in the form of color propagation that can be seen on the chromatography paper and the spots that are there to compare the spots from the sample and the spots from the standard.

Filter paper in paper chromatography is used as a stationary phase in the separation process. The selection of filter paper used is one of the determining factors for success in chemical separation and analysis. So in paper chromatography experiments the dyes will be distributed, so that the pigments can be easily separated and identified based on their color properties.

Learn more about paper chromatography at:

https://brainly.com/question/8937853

#SPJ4

The pump is dictating rather than facilitating your work. The pump could malfunction. There is no risk associated with the pump. A and B (The pump is dictating rather than facilitating your work AND The pump could malfunction)

Answers

The pump is essentially controlling the process instead of helping it. This means that the pump is not providing any assistance with the work, but is instead taking control of the process and not allowing any manual intervention.

This can be a problem because the pump could malfunction, which would mean that the process would be stopped in its tracks. If the pump malfunctions, it could be difficult or impossible to repair it and the process could be stalled until a new pump is brought in. This means that the process would be disrupted and could take a long time to get back on track.

In addition, the malfunction could cause other problems, such as leaking or failing to provide the necessary pressure. Thus, it is important to have a reliable pump that is up to the task in order to make sure that the process is smooth and efficient.

To learn more about pump visit:

https://brainly.com/question/19861803

#SPJ4

was a drought for a long period of time, what beak type would become more common in the ground finch population explain

Answers

One would anticipate a shift in the population of ground finches toward smaller, more pointed beaks in the event of a protracted drought.

What is population?

Population is a term used to refer to a group of individuals, typically humans, that inhabit a particular area or territory.

This is due to the likelihood that there will be less food available during a drought, especially small, hard seeds. Because they are more adept at breaking open tiny, difficult seeds, birds with smaller, quite pointed beaks seem to be better able to take advantage of the scarce food sources that are available. They would have an edge over birds with bigger, blunter beaks in terms of survival as a result. Natural selection would then favour birds with smaller beaks over time, increasing the proportion of birds with the this beak type in the population.

To learn more about population
https://brainly.com/question/29885712
#SPJ1

Other Questions
What is the purpose of a "sap"? What are the worst fears of the main character when tunneling near the enemy's trenches? Why does Corporal Hunter suddenly order the Write the answer to 3^4 x 3^7(i) in the form 3^x(ii) as an integer This region includes most of the continent's agricultural lands. A: Death ValleyB: Canadian ShieldC: Great PlainsD: coastal plain Certification programs are available to all of the following except:Answer: Four-year collages I am analysing a quote from a Christmas Carol. I need help with what to write about it. The quote is And Ill give you half a crown. This is what Scrooge says in stave 5. Which of the following is a one-to-one function? y = [[2x]], y = x^2, f(x) = { 4x + 1;x < -2 The ability of a lung to recoil, or recover from stretch, is called ________. Which of the following uses the ITA to investigate complaints of unfair trade practices?a. unclear policiesb. government policiesc. voluntary export restraintd. us Airport Auto Leasing has a ratio of cars to trucks that is 5 to 3. If each leasing center has 24 trucks, which auto leasing company has more cars? Main Street Auto Leasing has more cars since it has cars while Airport Auto Leasing has cars only What type of resource is solar and wind? How do you write a short prologue? Which of the following actions of an automobile firm will be considered as a strategic commitment?a. The firm spending $100,000 on renting a manufacturing facility to meet the temporary demand for its carsb. The firm launching an existing model of a car in red as a limited edition for six monthsc. The firm promoting its new model of coupe through a free Europe trip worth $15,000 to be won as an early bird offerd. The firm investing eight years and $4 billion to develop a range of hybrid cars with which it will compete in the future Sergio purchased 4 items for $1.50 each. Sales tax was 8.25%. What was the total price? please explain if you can, thxs! How do you calculate seed multiplication ratio? Frederick is looking for clerical job opportunities. He wants to make sure he has the right qualifications. What are the minimum requirements for the job roles that Frederick is applying for A women went to Shopping.First she spent 4/5th of all money she had in her purse, and then she lost 2/3 of what was remaining. Now she has 10$ left. How much money did she spent? An investigator wishes to use animals in an experiment that involves category B, C, and D activities performed on the same animal. How should the animal be categorized?A. Categories B, C, and D. B. Category B. C. Category C. D. Category D A pre-paid cell phone company charges $10.35 as a monthly access fee and $0.08 per minute of calling time.Express the monthly cost C in terms of minutes of call time ? What will the monthly cost be if you make 280 minutes of calls this month? Conider the following language \[ l=\left\{a^{n} b^{m}: n \neq m\right\} \] contruct finite automata, grammar ANSWER FOR BRAINLIST and 20 POINTS11. What belief did Thomas Jefferson have?