Which of the following is not one of the benefits accrued from a centralized purchasing function?
a. leverage purchase volume for better pricing
b. devote more resources to the supplier selection and negotiation process
c. maintain professional control over the purchasing process
d. increase the duplication of tasks

Answers

Answer 1

d. increase the duplication of tasks

One way is to complete VA Form 21-438, Statement in Support of Claim, and include a copy of the death certificate with the form.

What should be done with VA benefits after a death?

For deaths occurring on or after October 1, 2019, VA will pay up to $796 toward burial and funeral costs (if the deceased was hospitalized by VA at the time of death) or $300 toward burial and funeral costs (if the deceased was not hospitalized by VA at the time of death), as well as a $796 plot-interment allowance (if not buried in a national cemetery).

To know more about increase visit:

https://brainly.com/question/23970286

#SPJ4


Related Questions

To determine the time value of depositing $100 in a savings account, a person needs to know the interest rate and....
A.) her total income
B.) the rate of inflation
C.) whether the account is FDIC protected
D.) Whether the bank offers overdraft protection

Answers

Answer:

c

Explanation:

Why do I keep getting rejected for rentals?

Answers

Because of a person's income, rental applications are typically turned down.

What is person's income ?

The term "personal income" refers to all of a household's earnings in a particular year. It encompasses a variety of sources of income, including earnings, salaries, investments, dividends, rent, and any contributions made by a business to a pension plan, among others.

How do people get their money?

People obtain income through working for a living and investing their earnings in securities like stocks, bonds, and mortgage lending. For instance, the stock purchases of an investor may generate income in the shape of yearly dividends.

To know more about person's income visit:

https://brainly.com/question/7988107

#SPJ4

Paprus Inc. provided the following information for its manufacturing division: Revenues $650,000 Operating expenses $400,000 Service department charges $ 95,000 Invested assets $600,000 Assume that Paprus Inc. has established 20% as the minimum acceptable return on divisional assets. Determine the residual income for the manufacturing division.

Answers

Residual income for the manufacturing division is $155,000 - $31,000 = $124,000. Residual income for the manufacturing division can be calculated by subtracting operating expenses and service department fees from revenues to obtain net operating income.

Then multiply net operating income by the division's minimum acceptable return on assets (20%) and subtract that amount from net operating income. This difference is the residual income for the manufacturing division. In this case, net operating income is $650,000 - $400,000 - $95,000 = $155,000. Multiplying net operating income by the division's minimum acceptable return on assets (20%) yields $155,000 x 0.2 = $31,000.

To know more about residual income click here

https://brainly.com/question/14094616

#SPJ4

Can you have a 910 credit score?

Answers

Yes , you can have a credit score of 910 . A credit score between 881 - 960 is considered good.

Fair credit scores range from 721 to 880. Good is a score between 881 and 960. A score between 961 and 999 is regarded as excellent.

Credit score:

A credit score is a numerical representation of a person's creditworthiness derived from a level analysis of their credit files. A credit report, which typically contains data gathered from credit bureaus, serves as the primary foundation for a credit score. Your credit score is one of the factors the lender will consider when deciding whether to accept or deny your application for credit, such as a loan, mortgage, or credit card. It will also have an impact on the offer or interest rate that the lender makes to you.

Why is a good credit score so important?

Most of the time, a credit score is a three-digit number that lenders use to figure out whether you should get a mortgage, a credit card, or another type of line of credit, as well as the interest rate on that credit. At the time of your application, the score depicts you as a credit risk to the lender.

Learn more about credit score:

brainly.com/question/2573941

#SPJ4

What are the benefits of both life and health insurance?

Answers

Life and health insurance have the benefit that they provide essential protection to you and your loved ones.

With life insurance, you can ensure your family is taken care of financially in the event of your passing. Health insurance can keep you and your family covered in the event of a medical emergency or illness, helping to cover costs such as hospital bills and medications.

In addition, health insurance can provide preventive care services and regular checkups, helping to keep you and your family healthy. Investing in life and health insurance can provide peace of mind and security for you and your family.

Life and health insurance are essential tools for protecting yourself and your family. Life insurance helps provide financial security by providing a benefit to your loved ones if you pass away.

To learn more about insurance, click here:

https://brainly.com/question/25855858

#SPJ4

Which financial statement(s) reports the effects of transactions on common stock and retained earnings

Answers

Statement of changes in stockholders equality is the effects of transactions on common stock and retained earnings in financial statement report. The statement of owner's equity shows the change in retained earnings between the end of a period and the beginning.

In the stockholders equality, A statement of change also known as statement of retained earnings generally can be defined as a business' financial statement that measures the changes in owners' equity throughout a specific accounting period.  A statement of change also known as statement of retained earnings reporting net profit and also net loss through the stockholders.

Here you can learn more about Statement of changes https://brainly.com/question/30117519

#SPJ4

A retailer inflated the price of its dining room sets so that when it put them on sale, it appeared to customers that they were getting a better deal than they really were. In doing so, the retailer was engaged in _______. Multiple choice question.

Answers

Skimming the price. Skimming entails setting exorbitant costs when an item is first released and then progressively dropping the price when additional competitors come onto the scene. This kind of pricing is good for companies entering emerging areas.

How does retail inflation work?

The CPI tracks changes in the costs of goods and services at country, urban, and national levels as well as retail prices at a specific level for a certain item. CPI-based inflation, also known as retail inflation, is the term used to describe the change in the inflation figures over time.

What is inflation, exactly?

Inflation is defined as the rate of price growth over a predetermined time frame. The rise in the general price level or the increase in the cost of living in a country are two examples of broad measures of inflation.

To know more about  inflation visit:

https://brainly.com/question/30112292

#SPJ4

Which one of the following is not a defensive option for protecting a company's market share and competitive position? O Trying to convince dealers/distributors to handle the company's product line exclusively (which, if successful, forces competitors to use other distribution outlets) O Granting volume discounts or better financing terms to dealers and distributors to discourage them from experimenting with other suppliers O Thwarting the efforts of rivals to attack with a lower price by maintaining a lineup of product selections that includes economy-priced options for price-sensitive buyers
O Introducing new features, adding new models, and/or broadening the product line to close off gaps and vacant niches to opportunity-seeking challengers
O Pursuing continuous product innovation to draw sales and market share away from rivals with comparatively weak product innovation capabilities

Answers

Pursuing continuous product innovation to draw sales and market share away from rivals with comparatively weak product innovation capabilities for protecting a company's market share and competitive position.

What Is Market Share?

Market share is the percent of total sales in an industry generated by a particular company. Market share is calculated by taking the company's sales over the period and dividing it by the total sales of the industry over the same period.

Product innovation strategies:

1. Determine your company objectives

2. Understand your market at all times

3. Ensure you have a clear value proposition

4. strategy is realistic and that you have enough time, budget, and team power available to achieve

5. Execution

To know more about Product innovation, visit: brainly.com/question/25356187

#SPJ4

2. Luke borrowed $15,000 to pay his college tuition. After he graduates, he will repay the loan along with simple interest. After 2 years, Luke will owe a total of $17,250. What is the simple interest rate on Luke's loan

Answers

Answer:

7.5%

Explanation:

Given: Principal amount = $15,000

Time =- 2 years

Final Amount (Principal + interest)= $17,250

Interest = Final Amount - Principal amount

= $ ( 17250 - 15000  )

= $ 2250

Formula for interest : principal x rate x time

[tex]2250 = 15000 X rateX2[/tex]

→ [tex]rate = \frac{2250}{15000X2}[/tex]

⇒ [tex]0.075[/tex]

⇒ [tex]rate = 0.075 X 100[/tex]‰[tex]= 7.5[/tex]‰

Hence, the simplest interest rate on lukes loan =7.5%

A product-oriented layout would be most appropriate for which one of the following businesses?
a. fast food
b. steel-making
c. insurance sales
d. clothing alterations

Answers

A product-oriented layout would be ideal for the businesses of Fast food.

What is product-oriented layout?

High demand for the same or similar products characterizes a product-oriented layout. This layout is also known as a repetitive layout.

In layman's terms, product-oriented layouts are models that are organized around items with equivalent high low commodities or families. Consumer demand is strong enough to justify the significant investment in specialized equipment required for such a design. The commodity has been standardized or is nearing the end of its life cycle, which justifies investments in advanced equipment.

To know more about product-oriented layout visit:

https://brainly.com/question/19259832

#SPJ4

Green River Community College's scholarship fund receives a gift of $ 135000. The money is invested in stocks, bonds, and CDs. CDs pay 3.25 % interest, bonds pay 5.1 % interest, and stocks pay 7.1 % interest. GRCC invests $ 25000 more in bonds than in CDs. If the annual income from the investments is $ 7330 , how much was invested in each vehicle

Answers

GRCC invested $20,000 in stocks.

GRCC invested $70,000 in bonds.

GRCC invested $45,000 in CDs.

Investments in CDs = x

Investments in bonds = x+$25000

Investments in stocks = y

Total Investments = $135000

Annual Income =$6022.5

Therefore, x+x+25000 y = 135000

2x + y = 135000 - 25000 = 110000

0.0425x + 0.041(x + 25000) + 0.062y = 6022.5

0.0425.x+0.0410. x + 0.041 * 25000 + 0.062y = 6022.2 * 0.5

0.0835x + 0.062y = 6022.5 - 1025

0.0835x + 0.062y = 4997.5

By solving 2x+y=110000 and 35x + 0.062y = 4997.5 this gives,

2x+y=110000 Rightarrow 0.124x + 0.062y = 6820

0.0835x + 0.062y = 4997.5

0.124x-0.0835x+0.06201-0.06201 - 6820-4997.5

0.0405x = 1822.5

x = 1822.5/0.0405 =\$45000

Substitute x = $45000 into 2x + y = 110000 , this gives.

    (45000)+y=110000

y = 110000 - 90000 =\$20,000

Learn more about investments:

brainly.com/question/25300925

#SPJ4

ield testing assures that the cabling link meets the transmission performance requirements as defined by industry standards

Answers

Certification field testing assures that the cabling link meets the transmission performance requirements as defined by industry standards.

How to Certify Optical Fiber Cabling with OLTS and LSPM?

According to industry standards, each link's loss must be verified to fulfill performance standards using an LSPM or an optical loss test set (OLTS). The most significant testing in relation to new cabling systems is known as "basic" or Tier 1 Certification.

A double-ended test called Tier 1 Certification generates an absolute loss measurement.

The measurement is then contrasted with channel application standards and/or installation wiring standards. The DTX Cable Analyzer TM from Fluke Networks can accommodate multimode or single mode fiber test modules, automating the majority of the test and simplifying "basic" or Tier 1 certification.

The entire link loss results can likewise be provided by an OTDR. But the energy of the reflected light is what this measurement is based on. The fundamental certification must be carried out using an OLTS or LSPM, according to the specifications. A light source at one end and a light meter at the other produces more precise findings for link loss.

To know more about Optical Fiber Cabling visit:

https://brainly.com/question/21808066

#SPJ4

drag the item from the item Bank to its corresponding match this is a book listening words or other linguistic items in a particular category for subject with specialized information about them

Answers

The process of categorizing words for listening books or other linguistic items is known as taxonomy. Taxonomy is a system of classifying items into specific categories based on their common characteristics.

Taxonomy is used to organize and structure knowledge in a way that is easily understood and accessible. In the case of book listening words or other linguistic items, taxonomy involves classifying them into categories according to their meaning, origin, or purpose. For example, items can be categorized based on their purpose, such as fiction, non-fiction, poetry, etc. They can also be classified based on origin, such as items originally spoken in a certain language or items originating from a certain region.

To know more about taxonomy click here

https://brainly.com/question/19184314

#SPJ4

Does the company operating Singapore Kite Surf Magazine (see previous chapter) have a positive or negative working capital

Answers

Company operating Singapore Kite Surf Magazine will have a negative working capital.

What is Working Capital?

Estimates of working capital are determined from a balance sheet's variety of assets and liabilities. A corporation can better comprehend its near-term liquidity by focusing primarily on its current liabilities and offsetting them with its most liquid assets.

A company's operational effectiveness and immediate financial stability are also gauged by its working capital. If a business has a sizable positive net worth, it may be able to invest in growth and expansion. A business may experience difficulties expanding or reimbursing creditors if its current assets do not meet its current liabilities. In fact, it might fail.

To know more about working capital visit:

https://brainly.com/question/28391478

#SPJ4

While creating its AFI strategy framework, Valdez Consultants decided what markets the firm should compete in. By doing this, what type of strategy did the company devise

Answers

Valdez Consultants determined what areas the company should compete in while developing its AFI strategy framework. Corporate strategy entails determining where a corporation should compete, which covers industry, markets, and location.

What takes place in the AFI framework's analytical phase?

According to the AFI strategic framework, strategic analysis mainly entails assessing how internal factors and core capabilities may affect a company's ability to establish and maintain a competitive advantage.

What constitutes the framework for AFI strategic planning's main elements?

Analyze the firm's performance, external and internal analyses, and the strategic management process. Marketing strategy, management consulting, and global strategy should be formulated. Implement governance, business ethics, strategic leadership, and organization design.

To know more about AFI strategy visit:

https://brainly.com/question/28139132

#SPJ4

The difference between a lower selling price and a higher purchase price, resulting in a financial loss to the seller is known as

Answers

Capital gain or loss is simply the difference between an investment's selling price and cost or purchase price.

Capital gains occur when the selling price exceeds the cost price, while losses occur when the selling price falls below the cost price.

What distinguishes a lower purchase price from a higher selling price?

The difference between a higher selling price and a lower purchase price is the dollar profit, which is derived from the value increase of an asset.

What is the difference between the stock's highest buying and selling prices?

The difference between a security's highest and lowest offered purchase and sales prices is known as the bid-ask spread.

To learn more about Capital gain or loss here:

https://brainly.com/question/27880977

#SPJ4

Suppose you invest $230,000 in an annuity that returns constant annual payments over 9 years, with the first payment one year from now. At an interest rate of 7%, how much is the annual payment you receive

Answers

Two examples of lifelong guaranteed annuities that provide retirees with a consistent income flow until death are defined benefit annuities and Social Security.

The significance of paying

Payment refers to the exchanging of cash, commodities, or skills for agreed-upon quantities of respectable services and goods from all parties concerned. Payment options include cash, cheques, wire transfers, bank cards, direct debit, and cryptocurrencies in addition to the exchange of services.

What are the standard forms of payment?

The time rate scheme and the piece rate system are the two fundamental methods of compensation. Both methods have advantages and disadvantages. No methodology can be said to be appropriate at all times and in all situations.

Formula of present value of growing annuity: PVGA = A*[(1 - (1+g)^n/(1+i)^n)) / (i-g)

$250,000 = A*[(1 - (1+0.06)^5/(1+0.07)^5)] / (0.07 - 0.06)

$250,000*(0.01) = A*(1 - (1.06)^5/(1.07)^5)

$250,000*(0.01) = A*(1 - 0.9541363)

$2500 = A * 0.045864

A = $2,500 / 0.045864

A = 54508.983080412

A = $54,508.98

So, the amount of the first annual payment i will receive $54,508.98.

To know more about payment visit:

https://brainly.com/question/15136793

#SPJ4

The amount of the first annual payment I will receive will be upto $54,508.98.

How do you determine the annual payment?

The time rate scheme and the piece rate system are the two fundamental methods of compensation. Both methods have advantages and disadvantages. No methodology can be said to be appropriate at all times and in all situations.

Formula of present value of growing annuity: PVGA = A*[(1 - (1+g)^n/(1+i)^n)) / (i-g)

$250,000 = A*[(1 - (1+0.06)^5/(1+0.07)^5)] / (0.07 - 0.06)

$250,000*(0.01) = A*(1 - (1.06)^5/(1.07)^5)

$250,000*(0.01) = A*(1 - 0.9541363)

$2500 = A * 0.045864

A = $2,500 / 0.045864

A = 54508.983080412

A = $54,508.98

So, the amount of the first annual payment I will receive $54,508.98.

To know more about payment visit:

brainly.com/question/15136793

#SPJ4

Which items represent examples of Adam Smith’s "invisible hand" at work?
Correct Answer(s) 1.) An auto manufacturer uses imported leather for the seats in its vehicles. 2.) A tailor who makes suits for clients by hand buys his own suits off the rack.
Incorrect Answer(s) 1.) A cafe owner discards expired food, to avoid a fine from the health department. 2.) A gas station owner closes on certain days of the year, for religious reasons.

Answers

1.) An auto manufacturer uses imported leather for the seats in its vehicles. 2.) A tailor who makes suits for clients by hand buys his own suits off the rack represents examples of Adam Smith’s "invisible hand" at work.

What does Invisible hand mean?

Adam Smith developed the metaphor of the invisible hand in his book The Wealth of Nations (1776). It refers to the unseen forces of the free market that move resources and goods from where they are in surplus to where they are in deficit. It is the idea that people, acting in their own self-interest, will act in ways that benefit the economy as a whole.

What is a Free market ?

A free market is an economic system in which the prices of goods and services are determined by the unrestricted interaction between buyers and sellers, in which the laws and forces of supply and demand are free from any intervention by a government, price-setting monopoly, or other authority. It is a market characterized by a spontaneous and unregulated ordering of economic activities. It is a market system in which the prices of goods and services are determined by the open market and by consumers. In a free market economy, competition and supply and demand set prices and determine who gets the goods and services produced.

Therfore the correct option is A.1.) An auto manufacturer uses imported leather for the seats in its vehicles. 2.) A tailor who makes suits for clients by hand buys his own suits off the rack.

To know more about Free Market,

https://brainly.com/question/30088780

#SPJ4

A manager can increase return on investment (ROI) by doing which of the following?
a. Decrease operating expenses
b. Increase operating expenses
c. Increase operating assets
d. Decrease sales

Answers

Option (a) . A manager can increase return on investment (ROI) by decrease operating expenses.

What's included in operating expense?

Operating expenses — also known as selling, general and administrative expenses (SG&A) — are the costs of doing business. This includes rent and utilities, marketing and advertising, sales and accounting, administration and management salaries.

What are the 3 operating expenses examples?

If these costs are included, examples include auditor fees, bank charges, debt settlement costs, and interest costs. The definition of operating expenses may be extended to include the cost of goods sold, thereby covering all operational aspects of a business.

Where the operating expenses?

A company operating expenses, sometimes called OpEx, are reflected in the income statement. Along with non-operating expenses, it helps companies to calculate profitability.

To know more about Operating Expenses visit here:

https://brainly.com/question/14268337

#SPJ4

Today's boards are being exhorted not only to raise money and promote the organization but also to:

Answers

Today's boards are being exhorted not only to raise money and promote the organization but also to be more aggressive in monitoring performance.

What Is the Function of a Nonprofit Board of Directors?Private companies and governmental entities don’t begin to fulfill many of the services that the general public needs. This is why governments created a structure that provides tax exemptions for nonprofit organizations. Governments designed the nonprofit structure so that boards are responsible for managing public donations responsibly, and don’t take advantage of not having to pay taxes. The board directors are the leaders who provide strong organizational structure. The Internal Revenue Service (IRS) doesn’t specify exactly who may serve on a nonprofit board of directors, so boards have the flexibility to appoint whomever they choose.The nonprofit realm has developed best practices to address areas of nonprofit operations that state and federal governments omit.

To learn more about nonprofit operations refer to:

https://brainly.com/question/28488715

#SPJ4

The Financial Crisis. True or false? (LO2-4) a. The financial crisis was largely caused by banks taking large positions in the options and futures markets. B. The prime cause of the financial crisis was an expansion in bank lending for the overheated

Answers

False. The prime cause of the financial crisis was an expansion in subprime mortgage lending for the overheated housing market. Banks had taken large positions in the options and futures markets, but this was not the primary cause of the financial crisis.

What is financial crisis?

A financial crisis is a situation in which the value of financial assets unexpectedly drops significantly, resulting in a liquidity crisis. This can occur due to a variety of factors, including economic downturns, changes in interest rates, poor regulation, currency shifts, or large-scale fraud. During a financial crisis, investors may panic and sell off their assets, leading to a rapid devaluation of those assets

To learn more about financial crisis
https://brainly.com/question/25664180
#SPJ4

When faced with a difficult situation, kate ensures that she has the final word, even if she forcefully has her way. which kind of conflict resolution approach does kate follow? when faced with a difficult situation, kate follows a approach toward problem resolution.

Answers

The answer is Competing. There are five types of conflict resolution or conflict management; competing, avoiding, accommodating, and compromising.

What is Competing?You compete against the opposing team when you play sports. You compete for promotions at work. When you have siblings, you fight over everything. rivalry; to engage in conflict; to compete. to compete with one or more other people in order to achieve a goal, such as an advantage or victory. Competition is a rivalry in which two or more parties try to outdo one another in order to gain recognition, a prize, supremacy, profit, etc.; participate in a competition; vie: to compete in a race; to compete in business. There can never be a situation in which all competing ideas, demands, or interests are true or satisfied at once. They discussed the conflicting theories regarding the origin of life.

To learn more about profit refer to:

https://brainly.com/question/1078746

#SPJ4

Answer: Competing

Explanation: Hope it helps

In imperfectly competitive markets, increasing production will decrease the price of all units sold. This concept is known as the

Answers

All units sold will be less expensive if production is increased in markets with imperfect competition. Price effect is the name given to this idea.

What impact does imperfect competition have?

The following are the outcomes of imperfectly competitive markets: (1) too little is produced; ( 2) the product is sold at a price that is too high; and (3) the economy suffers as a result of the dead weight loss. In a nutshell, the economy incurs losses as a result of resource misallocation caused by imperfect competition.

How do prices change as a result of skewed competition?

A price that is higher than the marginal cost caused by imperfect competition can result in an inefficient use of resources. In a market with weak competition, businesses may spend a lot of money on advertising.

To learn more about Price effect here:

https://brainly.com/question/30046999

#SPJ4

economic principles are generalized statements that ______ consumer behavior.

Answers

Economic principles can be expressed as the inclinations of typical or average consumers, employees, or commercial firms.

What is Economic principles ?

Because of the simplification and elimination of complexity, generalisations and abstractions have practical use in the understanding of problems.

We can utilise historical data, for instance, to ascertain the connection between interest rates and customer behaviour. Because they must pay more in interest, higher interest rates cause consumers to quit borrowing. Positive economics does not involve any value judgements because it is purely factual and empirical.

The following principles apply: the principles of scarcity, cost-benefit analysis, unequal costs, comparative advantage, increasing opportunity costs, and the principle of equilibrium.

Learn more about Economics principles here

https://brainly.com/question/17476159

#SPJ1

End of Chapter Problem Suppose the government lowers taxes, leaving households with more disposable income, with no corresponding reduction in government purchases. In the accompanying diagram, shift the AD, LRAS, and/or SRAS curves and move the equilibrium point to its new position to demonstrate how the economy moves from one long-run macroeconomic equilibrium to another.

Answers

Line AD shifts to the right, Line SRAS moves shifts to the left Point E moves upward to new intersection.

What is Spatially resolved acoustic spectroscopy (SRAS)?The study of crystalline or polycrystalline materials frequently makes use of the non-destructive acoustic microscopy microstructural-crystallographic characterization technique known as SRAS (spatially resolved acoustic spectroscopy). The method can provide details about the material's crystallographic alignment and internal structure. Traditionally, diffraction methods from electron microscopy, such EBSD, have been used to get the data that SRAS provides. In 2005, the method was patented.The surface acoustic wave (SAW) velocity is measured by SRAS over a specimen. The SAW velocity is a function of the material state, which includes elements like temperature, stress, crystallographic orientation, and elastic constants.Two lasers are utilised in SRAS measurements, as is common in laser ultrasound methods, with one laser used to create the acoustic waves and the other to detect them afterwards.

Learn more about SRAS refer to :

https://brainly.com/question/26875448

#SPJ4

\

The difference between fiscal policy and monetary policy is that Group of answer choices fiscal policy involves the promotion of competition and monetary policy involves collecting money to pay for taxes monetary policy involves regulation of the money supply and fiscal policy involves government spending and taxing fiscal policy involves regulation of natural monopolies and monetary policy involves the provision of public goods fiscal policy is macroeconomic policy and monetary policy is microeconomic policy monetary policy is macroeconomic policy and fiscal policy is microeconomic policy

Answers

Out of the alternatives provided above, it can be stated that 'monetary policy involves regulation of the money supply and fiscal policy involves government spending and taxing' clearly indicates the differences between both the policies. Therefore, option B holds true.

The monetary policies are much similar and a lot different from the fiscal policies at the same time. Both are related to the management of monies in some way or the other. The former is a macroeconomic phenomenon, whereas, the latter is to look after the taxation schemes in the economy.

Learn more about monetary policies here:

https://brainly.com/question/29694955

#SPJ4

Caroline buy 2 oda and 4 tea for £7. Olivia buy 1 oda and 5 tea for £7. 25. Work out the cot of one oda and one tea

Answers

The cost of one oda and one tea is £2.50. This is calculated by dividing the total cost of the two orders (£14) by the total number of items purchased (12).

What is purchased?

Purchasing is the process of acquiring goods or services in exchange for money. It involves selecting a product or service, making payment arrangements, and taking possession or delivery of the purchased item. Purchasing is a necessary part of running a business, as it involves the acquisition of essential materials and services. Purchasing can also be done for personal reasons, such as when buying a car or a home. In both cases, the buyer must evaluate the item being purchased and make an informed decision.

This works out to be £1.17 per item. Since there are two types of items (oda and tea) and they are sold at the same price, the cost of one oda and one tea is £2.50 (2 x £1.17).

To learn more about purchased
https://brainly.com/question/29102621
#SPJ4

The logging industry has had a very productive thirty years and as a result, the demand for labor has been increasing a little each year and equilibrium wages rose each year. If the logging industry productivity were to slow down, what is likely to happen to equilibrium wages

Answers

Even if there was no increase in demand for labor, wages would continue to rise, leading to an increase in the natural rate of unemployment.

What is inherent in the natural unemployment rate?

A healthy economy can only maintain the natural rate of unemployment at its lowest point without creating inflation. There are three types of natural unemployment: structural, surplus, and frictional unemployment all exist. Because employers would first raise wages, zero unemployment cannot be achieved.

What factors alter the natural unemployment rate?

The natural rate of unemployment (NRU) can fluctuate over time as a result of things like shifts in the characteristics of the labor force. Changes in structural and frictional unemployment can alter the NRU.

To learn more about unemployment here:

https://brainly.com/question/14227610

#SPJ4

Think of a favorite product that you have. What do you think ALL of the things are that have to happen before you see the product in the store?

Answers

The transformation of raw materials into finished goods. Natural items are transformed into goods that can be sold on the market through manufacturing.

What are the initial steps ?

The acquisition and monitoring of raw materials is the initial step in inventory management. The environment can be mined for raw materials or they can be purchased from sources. Once received, raw materials must be kept in storage until they are needed for manufacturing. Systems of inventory keep track of the quantity, location, and state of each raw item.

Work in process refers to the production process from storage to the assembly line. Production might be carried out internally or contracted out to manufacturers. Inventory management systems monitor the production process and the finished goods as they are produced in both scenarios.

The number, location, and state of each end product must be monitored. The system is updated in response to product purchases to account for the drop in inventory following distribution.

To know more about Distribution, visit:

https://brainly.com/question/20437331

#SPJ1

pyramids were designed to be ?
A.regional palaces
B. temples
C. government
D. tombs

Answers

Answer:

D

Explanation:

tombs

Answer:

D

Pharoahs needed to be buried under the pyramids, which would make them tombs

Other Questions
Solve for x: 3x + 2 < 14 and 2 x-5> -11. f(n) = 2n-1 find the arithmetic sequence ? Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational