What’s the pattern? You start with 14 and a half, but then you get 12 and three fourths. How does that happen?

Answers

Answer 1

In math, a pattern is defined as a sequence of repeating objects, shapes or numbers. We can relate a pattern to any type of event or object.

What’s the pattern?

A pattern has a rule that identifies the items that are part of the pattern and those that are not. A pattern in mathematics is a series of recurring figures, shapes, or numbers.

Any kind of event or thing can be connected to a pattern. A pattern has a rule that identifies the items that are part of the pattern and those that are not. A specific set of rules must be taken into account in order to create a full pattern.

We must first comprehend the nature of the sequence and the distinction between the two successive numbers provided in the pattern in order to apply these rules. 

To learn more about pattern refer to:

https://brainly.com/question/27445568

#SPJ1


Related Questions

Use the diagram to find the indicated angle measures. Please do 1, 2, and 3. Please need ASAP!!!!!!!!!!!!!!! 30 POINTS

Answers

The measures of given figures are m∠ADC is 90 degrees and m∠DAC will be 34 degrees

What is Triangle?

A triangle is a three-sided polygon that consists of three edges and three vertices.

Given m∠B= 57 degrees

m∠c= 51 degrees

segment AD bisects m∠BAC

then  m∠ADC we need to find.

As AD is perpendicular to BC, the angle of  m∠ADC is 90 degrees.

Given m∠B= 66 degrees

m∠BAD=34 degrees

Now we need to find m∠DAC

m∠DAC will be 34 degrees

Hence, the measures of given figures are m∠ADC is 90 degrees and m∠DAC will be 34 degrees

To learn more on Triangles click:

https://brainly.com/question/2773823

#SPJ1

HELPPP ASPPO!!
4x -y=6
-4x +y =8
which statement correctly describes the system of equations

Answers

The equation system is appropriately described by the formula 4x - y=6.A mathematical formula known as an equation combines two assertions .

what is equations ?

A mathematical formula known as an equation combines two assertions using the equal sign (=) to denote equivalence. The terms 3x + 5 and 14 are separated by an equal sign in the equation 3x + 5 = 14, for example. Mathematical equations are used to express the relationship between two phrases on either side of a letter. In most cases, the symbol serves as the sole variable. a good example is 2x - 4 = 2.

given

Graphing, substitution, and elimination are the three techniques used to solve systems of equations.

By graphing the given equations, you can easily solve a system by finding the point(s) where they all cross.

The values of the variables you are solving for will be provided by the coordinate of this point.

The equation system is appropriately described by the formula 4x - y=6.

To know more about equation visit:

https://brainly.com/question/649785

#SPJ1

what is 3 3/4 - 1 1/4?

Answers

Answer:

2 2/4 or 2 1/2

Step-by-step explanation:

3-1=2

3/4-1/4=2/4

2/4=1/2

25.05+36.05 equal the answer

Answers

Answer:

61.1

Step-by-step explanation:

Here, we simply add the two numbers together.

25+36=61

0.5+0.5=1

so, the answer is 61.1

25.05 + 36.05 is rounded to 61.6

Manuel will rent a car for the weekend. He can choose one of two plans. The first plan has an initial fee of $60 and costs an additional $0.60 per mile driven
The second plan has no initial fee but costs $0.80 per mile driven.
For what amount of driving do the two plans cost the
same?
miles
What is the cost when the two plans cost the same?
3

Answers

From the given values and conditions, We need to form a equations and equate both sides to solve for the miles, The answer is 300 miles.

What is a equation?

An equation is a statement of equality between two expressions. It typically includes numbers and mathematical operations such as addition, subtraction, multiplication, and division. For example, the equation 2x + 3 = 7 is a statement that the value of the expression 2x + 3 is equal to the value of 7. Equations can also include variables, which represent unknown values that can be solved for.

What is unitary method?

The unitary method is a method used in mathematics to solve problems involving units of measurement. It involves expressing the units of measurement as a fraction or multiple of a single unit and then using this fraction or multiple to solve the problem. The method is particularly useful in solving problems involving conversions between different units of measurement. The unitary method is particularly useful in solving word problems where the conversion of units is required. It involves expressing the given information in terms of a single unit and then using that information to find the unknown quantity.

x= miles

60+0.6x=0.8x

0.8x-0.6x=60

0.2x=60

x=60/0.2

=300 miles

To learn more about equations visit:

https://brainly.com/question/29657983

#SPJ1

Geometry need help asap

Answers

On solving the provided question, we can say that -  here in quadrilateral we have x + 146 + 47 + y = 360 => [tex]x= 83.5[/tex]

what is quadrilateral?

A quadrilateral is a four-sided polygon in geometry that has four edges and four corners. The word is a derivative of the Latin words quadri and latus (meaning "side"). Having four sides, four vertices, and four corners, a rectangle is a two-dimensional form. Concave and convex come in primarily two varieties. Additionally, there are several subclasses of convex quadrilaterals, including trapezoids, parallelograms, rectangles, rhombuses, and squares. Four straight sides make up a rectangle, which is a two-dimensional form. There are several different types of quadrilaterals, including parallelograms, trapezoids, rectangles, kites, squares, and rhombuses.

here,

x + 146 + 47 + y = 360

2x + 193 = 360

2x = 167

[tex]x= 83.5[/tex]

To know more about quadrilateral visit:

https://brainly.com/question/29934291

#SPJ1

Find the compound ratio of 2:3 and 5:4

Answers

The compound ratio of natural number ratios 2 : 3 and 5 : 4 is equal to 5 : 6.

How to determine a compound ratio

Herein we must determine a compound ratio, that is, the product of two ratios, whose definition is shown below:

For a : b and c : d, where a, b, c, d are natural numbers, the compound ratio is equal to (a · c) / (b · d).

If we know that a : b = 2 : 3 and c : d = 5 : 4, then the compound ratio is equal to:

r = (2 · 5) : (3 · 4)

r = 10 : 12

Finally, we simplify the resulting expression:

r = 5 : 6

To learn more on ratios: https://brainly.com/question/13419413

#SPJ1

A parade traveled 8 miles in 4 hours. How far did the parade travel per minute?

Answers

Answer:

1/30 of a mile per minute.

Step-by-step explanation:

8/4 = 2 miles per hour.

2/60 = 1/30 of a mile per minute.

they are yes and no choices except the one that’s one the pic
helpppp

Answers

Therefore , the solution of he given problem of linear equation comes out to be x = 5.

A linear equation is defined.

A linear equation is one that has the form y=mx+b in algebra. B is the slope, and m is the y-intercept. It's usual to refer to the previous clause as a "linear equation with two variables" because y and x are variables. The two-variable linear equations known as bivariate linear equations. There are several instances of linear equations: 2x - 3 = 0, 2y = 8, m + 1 = 0, x/2 = 3, x + y = 2, and 3x - y + z = 3. It is referred to as being linear when an equation has the form y=mx+b, where m stands for the slope and b for the y-intercept.

Here,

Given : 2x-4=6

To prove x =5

Thus,

We have to find the value of x

[tex]= > 2x =10\\= > x =10/2\\= > x =5[/tex]

Therefore , the solution of he given problem of linear equation comes out to be x = 5.

To know more about linear equation visit:

brainly.com/question/11897796

#SPJ1

Help asap PLSSS!! I’d really appreciate it. Thank you!!

Answers

The value of x and y in equations 17x - y = 40 and 2x + 4y = 50 are x = 3 and y = 11.

What is equation ?

The definition of an equation in algebra is a mathematical statement that demonstrates the equality of two mathematical expressions. For instance, the equation 3x + 5 = 14 consists of the two equations 3x + 5 and 14, which are separated by the 'equal' sign.

A mathematical statement known as an equation is made up of two expressions joined together by the equal sign. A formula would be 3x - 5 = 16, for instance. When this equation is solved, we discover that the value of the variable x is 7.

A mathematical expression with an equals sign is referred to as an equation. Algebra is widely used in equations. When performing calculations but unsure of the precise amount, algebra is used.

17x - y = 40  ⇒ (1)

2x + 4y = 50 ⇒ (2)

(1)* 4

68x - 4y = 160

Adding equation (1) and (2)

68x - 4y = 160

2x + 4y = 50

⇒ 70 x = 210

        x = 3

Substituting the value of x in equation (1)

17*3 - y = 40

51 - y = 40

-y = 40 - 51

-y = -11

y = 11

To learn more about equation from the given link  

brainly.com/question/2972832

#SPJ1

the terms rising action and climax best describe which narrative element?

Answers

Rising action and climax are best used to describe the narrative element of Plot.

What are rising action and climax ?

The rising action of the novel encompasses all the developments of the characters and the dramatic events that build to the eventual climax. The most thrilling section of the story is the climax, which also marks a turning point in the plot or the objectives of the main character.

Rising action in literature refers to all the incidents that take place in a narrative leading up to the climax. The tale moves along thanks to the mounting action, which also heightens the tension and keeps us interested in what happens next. It comes after the first step of exposition in the plot.

Find out more on rising action at https://brainly.com/question/12511586

#SPJ1

Solve the equation for X,
2 (2) + x = 4
A. x=8
B. x=0
C. x= -4
D. x=4

Answers

Answer: x=0

Step-by-step explanation:

2(2)=4

4+x=4

-4 on both sides

so x=0

Answer:

B) x = 0

Step-by-step explanation:

We will get our equation in here first. Our equation is:

2 * 2 + x = 4

We simplify the multiplication giving us:

4 + x = 4

Finally, we subtract 4 from both sides to find the value of x. We get:

x = 0.

So the correct answer is B) x = 0.

Hope this helped!

How many possible triangles can be created if measure of angle A equals pi over 6 comma c = 18, and a = 9?

0 triangles
1 triangle
2 triangles
Cannot be determined based on the given information

Answers

If the measure of angle A equals pi over 6, the angle c equals 18, and the angle an equals 9, triangles may be formed.

When do three lines join to make a triangle?

You only need to apply the Triangle Inequality Theorem, which asserts that the sum of a triangle's two side lengths is always greater than the third side. A triangle will exist if this holds true for each of the three possible added side length combinations.

From the given information, we have that:

m<B = pi/6 = 30 degres

c = 10

b = 5

This shows that we can use the cosine rule to find the third side b of the triangle. Since all the sides are complete, hence we can use the information given to find just 1 triangle

To know more about angle visit :-

https://brainly.com/question/13954458

#SPJ1

Easy Cooking is a cooking supply company. Last year, the company sold 32,010 ovens. This year, they sold 30% fewer ovens than that. How many ovens did they sell this year?

Answers

Answer:

9,603 ovens

Step-by-step explanation:

Given:

Last year ---> 32,010 ovens

This year ---> 30% of last year

Question:

How many ovens did they sell this year?

Work:

To find out how many ovens they sold this year, all of you have to do is just multiply 30% by 32,010, the amount of ovens they sold last year

32,010 * 0.3 = 9,603

Solution:

Easy Cooking sold 9,603 ovens this year.

Hope this helped! :D

A table and 4 chairs costs N82. If the table costs N25, what is the cost of each chair? Find the total cost of 2 tables and 6 chairs​

Answers

Answer:

Step-by-step explanation:buordjkdkeek

You have a 1/3 -teaspoon measuring spoon and a 1/2-teaspoon measuring spoon. What are two ways you can measure 3 1/6 teaspoons of salt?

Answers

Answer: One way to measure 3 1/6 teaspoons of salt using 1/3 -teaspoon and 1/2 -teaspoon measuring spoon is to use:

the 1/2 teaspoon measuring spoon 3 times to measure 3/2 = 1 1/2 teaspoons

and use the 1/3 teaspoon measuring spoon 6 times to measure 6 * 1/3 = 2/3 teaspoons

3 1/2 + 2/3 = 3 1/6

Another way to measure 3 1/6 teaspoons of salt using 1/3 -teaspoon and 1/2 -teaspoon measuring spoon is to use:

the 1/3 teaspoon measuring spoon 6 times to measure 6 * 1/3 = 2/3 teaspoons

and use the 1/2 teaspoon measuring spoon 6 times to measure 6 * 1/2 = 3 teaspoons

3 + 2/3 = 3 1/6

So, there are two ways to measure 3 1/6 teaspoons of salt using 1/3 -teaspoon and 1/2-teaspoon measuring spoon, one is by using 3 times 1/2 teaspoon measuring spoon and 6 times 1/3 teaspoon measuring spoon and the second one is by using 6 times 1/3 teaspoon measuring spoon and 3 times 1/2 teaspoon measuring spoon.

Step-by-step explanation:

12 divided by four
plus 2 x 6+4

Answers

Answer:

19

Step-by-step explanation:

12 divided by four plus 2 x 6+4

assuming that the question is:

12 : 4 + 2 x 6 + 4 =

3 + 12 + 4 =                     (remember PEMDAS)

19

The temperature during the night was -4. In the morning the temperature increased by 3. What is the temperature in the morning

Answers

Answer:

-1

Step-by-step explanation:

Night: -4
Morning: -4 + 3 = -1

p.
Sue uses of a pitcher of sweet tea to fill
each of 6 matching glasses. What fraction of
the pitcher does Sue use to fill 1 glass?

Answers

Answer:

P. Sue uses 1/6 of the pitcher to fill 1 glass

Step-by-step explanation:

During a fundraiser, Kate wants to sell the same number of $5 candy bars as $2 candy bars. The expression that represents how much money Kate will collect is . Identify any variables, constants, and coefficients and explain what they mean in terms of the expression representing this scenario.

Answers

The expression that represents how much money Kate will collect

is y = 5x + 2x.

What is an equation?

An equation is written in the form of variables and constants separated by the operation of multiplication and division,

An equation states that terms in different forms on both sides of the equality sign are equal.

Multiplication and division do not separate the terms of an equation.

Given, During a fundraiser, Kate wants to sell the same number of $5 candy bars as $2 candy bars.

Let, The number of candies she sold be 'x' and the total cost of the candies be 'y'.

Therefore, The phrase that describes the amount of money Kate will bring in is y = 5x + 2x.

y = 7x.

learn more about equations here :

https://brainly.com/question/29657988

#SPJ1

Use partial quotients to solve 5,140 ÷ 9 = ___.

Answers

The correct answer is 571 quotient and 1 is remainder.We can solve easily by partial quotients.

What are partial quotients division?

Partial quotients division is a deviation from the standard method. The divisor is multiplied with a number and the multiple obtained is deducted from the dividend. This multiple of the divisor is as close as possible to the dividend, that is less than or equal to the dividend.

Why do we use partial quotient division?

Partial quotient division provides natural differentiation because we can have students solve at a level they are comfortable with and then we can challenge them to find a more efficient way. And this means using fewer steps and solve easily.

Now we solve

first 9 multiply with 500 so we get 4500. 5140-4500=640

then 9 multiply with 70 so we get 630. 640-630=10

then 9 multiply with 1 so we get 9.   10-9=1

Hence       500+70+1=571

And our remainder is 1.

To learn more about partial quotient division visit;

https://brainly.com/question/21052588

#SPJ1

Two parallel lines are crossed by a transversal.

Horizontal and parallel lines b and c are cut by transversal a. At the intersection of lines b and a, the bottom right angle is 50 degrees. At the intersection of lines c and a, the top left angle is y degrees.
What is the value of y?

Answers

The value of y is 130°

What are corresponding angles?

The angles occupy the same relative position at each intersection where a straight line crosses two others. If the two lines are parallel, the corresponding angles are equal.

Given here:

Horizontal and parallel lines b and c are cut by transversal a. At the intersection of lines b and a, the bottom right angle is 50 degrees. At the intersection of lines c and a, the top left angle is y degrees.

Thus the angle adjacent to the 50-degree angle will be 130

but this angle corresponds to the angle y thus y=130 as corresponding angles are equal when a transversal intersects two parallel lines

Hence, The value of y is 130°

Learn more about angles here:

https://brainly.com/question/11806229

#SPJ1`

Help me please 35 points on the line

Answers

Answer shown in bold

401924109147

The non-bolded values to the left are not to be typed in the answer box. They're present to keep track of the values. In other words, you'll type "40" without quotes into the first box, then "19" without quotes in the second box, and so on.

========================================================

Explanations:

Add up all of the values in the Venn diagram to find the total. Therefore, 9+10+14+7 = 40 students were surveyed.We add the values in the "social interaction activities" circle only. There are 9+10 = 19 students here.This time add up the values in the "technology driven activities" to get 10+14 = 24 students.The answer is 10 because this value is in the overlapped region between the two circles. The answer is 9 since this value is in the "social interaction activities" circle, but outside the other circle. The answer is 14 as this value is in the "technology driven activities" circle, but outside the other circle.The answer is 7 because this value is outside both circles.

Let me know if you have any questions.

Colton works in a department store selling clothing. He makes a guaranteed salary of $500 per week, but is paid a commision on top of his base salary equal to 10% of his total sales for the week. How much would Colton make in a week in which he made $1075 in sales? How much would Colton make in a week if he made xx dollars in sales?

Answers

Answer:

Step-by-step explanation:

If Colton makes a guaranteed salary of $500 per week, and he is paid a commission of 10% on top of that for a total of $1075 in sales, he would make an additional $107.50 in commission (1075 x .1 = 107.5). In total, Colton would make 500 + 107.5 = $607.50 in a week where he made $1075 in sales.

Write the following expression in expanded form:9 to power of 3× 7to the power of 4

Answers

Exponential Expressions into Expanded Form into Answer:

[tex]9^{3}[/tex] = 9⋅9⋅9 = 729

[tex]7^{4}[/tex] = 7⋅7⋅7⋅7 = 2401

I hope this helps, have a good day!

Answer:


= 9⋅9⋅9 = 729

= 7⋅7⋅7⋅7 = 2401

Step-by-step explanation:

8z = 4x - 32

Please explain step by step

Answers

The solution to the equation 8z = 4x - 32 is z = -4 and x = 8.

What is equation?

An equation is a mathematical statement that states that two expressions are equal. It consists of an equals sign and two expressions, one on each side of the equals sign. Equations are used to solve for the value of the unknown expressions, and can be used to solve problems in various fields such as physics, chemistry, engineering, and mathematics.

1. Start by isolating the z variable by subtracting 4x from both sides of the equation. This will give us: 8z = -32.
2. Divide both sides of the equation by 8. This will give us: z = -4.
3. Finally, substitute z = -4 into the original equation and solve for x. This will give us: 4x = 32, so x = 8.

Therefore, the solution to the equation 8z = 4x - 32 is z = -4 and x = 8.
To know more about equation click-
https://brainly.com/question/2972832
#SPJ1

Complete questions as follows-
8z = 4x - 32
Please explain step by step how to solve 8z = 4x - 32.

Help soon would be greatly appreciated

A home has a replacement value of $324,000. What is the amount
of the insurance if the coverage is:
a.
100% of the replacement value?
b. 90% of the replacement value?
C.
80% of the replacement value?

Answers

The insurance company will pay $192, which is the asset's present value.

What is meant by replacement value?

The sum of money required to fix your house at the cost of construction materials today, or to replace your possessions at the cost of an equivalent or comparable item today the cost of purchasing a comparable asset to replace an existing one at the going rate on the market.

To be fully insured, your dwelling limit must equal at least 80% of the rebuild value of your house. The average cost of reconstructing a home per square foot in your area can be multiplied by the square footage of your home to determine the replacement cost. Market value and replacement cost are not the same thing.

Therefore,

The distribution of cost over the course of an asset's useful life is known as depreciation. It speaks of the rate at which the value of an asset depreciates over time.

When figuring out depreciation, the original value is utilized. It does not use current market value.

Over the course of the asset's useful life, the value is distributed equally.

In this instance

Depreciation per year = Asset value ÷ Years of useful life

Depreciation per year = 288 ÷ 6 = $48

The asset has been used for 2 years

Amount depreciated = 48 × 2 = $96

Present value = Original value - Depreciation

Present value = 288 - 96 = $192

To learn more about replacement value, refer to:

https://brainly.com/question/27343514

#SPJ1

Find the radius of the circle, if the big square is 30 square units more than the area of the small square.

Answers

Answer:

The area of a square is equal to the side length of the square squared. If the side length of the small square is "s" and the side length of the big square is "b", then we can write the following two equations to represent the area of the two squares:

Area of small square = s^2

Area of big square = b^2

Since the area of the big square is 30 units more than the area of the small square, we can write the equation:

b^2 = s^2 + 30

To find the radius of the circle, we need to find the side length of the small square. To do this, we can rearrange the equation above to solve for s:

s^2 = b^2 - 30

s = sqrt(b^2 - 30)

Now we just need to find the value of "b", which is the side length of the big square. To do this, we can use the fact that the big square is inscribed in the circle, so the side length of the big square is equal to the diameter of the circle. Let's call the diameter of the circle "d". Then we can substitute "d" for "b" in the equation above:

s = sqrt(d^2 - 30)

To find the radius of the circle, we just need to divide the diameter of the circle by 2, so the radius is equal to "d" divided by 2. Therefore, the radius of the circle is:

r = d/2 = sqrt(d^2 - 30)/2

So to find the radius of the circle, we just need to know the diameter of the circle. Can you provide the diameter of the circle in the question?:

The radius of the circle is: r = d/2 = sqrt(d^2 - 30)/2

What is area of circle?

The area of a circle is π multiplied by the square of the radius. The area of a circle, (A) when the radius 'r' is given is πr2. π is approximately  3.142

Here, we have,

The area of a square is equal to the side length of the square squared. If the side length of the small square is "s" and the side length of the big square is "b", then we can write the following two equations to represent the area of the two squares:

Area of small square = s^2

Area of big square = b^2

Since the area of the big square is 30 units more than the area of the small square, we can write the equation:

b^2 = s^2 + 30

To find the radius of the circle, we need to find the side length of the small square. To do this, we can rearrange the equation above to solve for s:

s^2 = b^2 - 30

s = sqrt(b^2 - 30)

Now we just need to find the value of "b", which is the side length of the big square. To do this, we can use the fact that the big square is inscribed in the circle, so the side length of the big square is equal to the diameter of the circle. Let's call the diameter of the circle "d". Then we can substitute "d" for "b" in the equation above:

s = sqrt(d^2 - 30)

To find the radius of the circle, we just need to divide the diameter of the circle by 2, so the radius is equal to "d" divided by 2. Therefore, the radius of the circle is:

r = d/2 = sqrt(d^2 - 30)/2

So to find the radius of the circle, we just need to know the diameter of the circle.

To learn more on area of circle click:

brainly.com/question/22964077

#SPJ2

2. Avea checked out 18 books
from the library. Half of them
are nonfiction. How many
nonfiction books did she check
out?

Answers

Solution -

18 Total books
Half of 18 is 9
(18 divided by 2)
So Avea checked out 9 nonfiction books

Answer: she checked out 9 nonfiction books

Step-by-step explanation:

18-9=9

Solve for -10 - 9/2 x <80

Answers

Answer:

X > -20

Step-by-step explanation:

-10 - 9/2 x < 80

Move 10 to the other side

- 9/2 x < 80 + 10

Simplify

-9/2 x < 90

-9 x < 180

x > -20

(We switch the inequality sign if we are dividing with negatives)

Other Questions
Tamara and Clyde got different answers when dividing 2x4 + 7x3 18x2 + 11x 2 by 2x2 3x + 1. Analyze their individual work.Which statement about their answers is true? Tamaras work is correct because Clyde did not multiply the terms in the division table correctly.Clydes work is correct because Tamara did not subtract the terms correctly.Both students are correct.Both students are incorrect. Solve for x: 3x + 2 < 14 and 2 x-5> -11. f(n) = 2n-1 find the arithmetic sequence ? Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA