What is the absolute location of Texas?

A. 30° N, 90° W
B. 35° N, 100° W
C. 40° N, 80° W
OD. 100° N, 30° W

What Is The Absolute Location Of Texas?A. 30 N, 90 WB. 35 N, 100 WC. 40 N, 80 WOD. 100 N, 30 W

Answers

Answer 1

Answer:

D

Explanation:

There really is no explanation. The evidence is on the paper


Related Questions

True or false The English Bill of Rights had no direct bearing on the U.S. Constitution's Bill of Rights and on other important U.S. documents

Answers

"The English Bill of Rights had no direct bearing on the U.S. Constitution's Bill of Rights and on other important U.S. documents" is a false statement.

What do you mean by Constitution Bill?

Constitutional Bill is a Bill which have the effect of adding, amending or repealing any of the provisions of the Constitution.

The English Bill of Rights is an act that was passed on December 16, 1689 by the Parliament of England. The Bill limits the powers of the king and queen, create separation of powers and enhances the democratic election.

The English Bill of Rights prevents the establishment of Catholic religious institutions but cannot separate state and church. Reflecting Locke's influence on America's founding fathers, the American Bill of Rights separated state and church.

Therefore, This statement is False.

Learn more about Constitution Bill, here;

https://brainly.com/question/29617006

#SPJ1

explain the characteristics of states as they emerged?​

Answers

Answer:

Characteristics of a state: Population, Territory, Sovereignty, and Government. Divine right theory: The doctrine that states the right of rules in a monarch (one ruler) is developed directly from God and is only accountable to God because God created the state.

Explanation:

A state is characterized by four distinct factors and these are:-

1. A state cannot exist without people. It must have a population

regardless of the number of this particular population.

2. A state exists with clearly defined territorial borders. These borders

determine the size of the state and the area it can govern.

3. A state must have an established government. This means it should

be able to develop laws and have the capacity to enforce the same within

its borders. The government should also be recognized by other states

globally.

4. A state must be sovereign. This means it should have the full right to

govern itself without interference by external entities.

From the above characteristics a state can be defined as an independent

geographical territory with a population governed by established laws

What was the result of the October Revolution (Nov. 7-8, 1917)?


an American style democracy was set up

Rasputin became tsar

Lenin and the Bolsheviks took control of the government

the tsar adopted communism

Answers

Answer:

Establishment of the Soviet union in 1922

Which of the following was not a reason most white immigrants settled in the middle colonies?

A) Land was Scarce in the New England Colonies.
B) these colonies offered a relatively secular and classless society
C) There were fewer economic opportunities in the southern colonies
D) the middle colonies offered vast tracts of land to the immigrants

Answers

Answer: A) Land was scarce in the New England Colonies was not a reason most white immigrants settled in the middle colonies.

Explanation: The middle colonies offered vast tracts of land to the immigrants, which was one of the main reasons for white immigration to this region. The other reasons for immigration to the middle colonies were the relatively secular and classless society and the availability of economic opportunities.

Answer:the middle colonies offered vast tracts of land to the immigrants.

Explanation: Correct. Although most white immigrants settled in middle colonies, most of them worked small plots of land and earned a modest living. -edmentum

Many southern states felt that they had joined the Union freely, and should be allowed to leave. This would be their right to:

Answers

Many southern states felt that they had joined the Union freely, and should be allowed to leave. This would be their right to freedom.

Why did the Southern states feel they could leave the Union?

Southern states feared that the Republican administration would try to outlaw slavery. The Southern states were terrified that their states' rights would be infringed if slavery was abolished, which would completely destroy their economies. South Carolina was the first state to leave the Union.

Congress mandated that Southern states adopt new constitutions guaranteeing the right to vote for African-American men in order to be admitted to the Union. The Fourteenth Amendment, which gave African Americans equal legal protection, also had to be ratified by the Constitution.

Learn more about southern states, here:

https://brainly.com/question/14079520

#SPJ2

Franco and Indian war
“The last of the Mohicans”

1- describe the relationship the colonist and the Mohicans Indians?

2- why were the colonist living in such a defenseless place?

3- how do the British officers treat Indian Allies

4- describe some of the colonist develop for the British and their laws?

5- how did the Huron chief try to be fair?

6- what Is chengachook prediction for the country?

Answers

The colonist were living in such a defenseless place because they were new to the environment

Corn plants and milkweed plants grow in the same area. Over several years, the milkweed plants have taken over the field and the corn plants no longer have space to grow.

This best demonstrates which type of an interaction between the plants?

cooperation
parasitism
commensalism
competition

Answers

The best description of the type of interaction between the plants of corn plants and milkweed is d. competition

What is competition in nature ?

More broadly, competition can be described as the direct or indirect contact of organisms that results in a change in fitness when the organisms share a resource. Competition is most commonly thought of as the interaction of individuals that compete for a common resource that is in limited supply. The weaker competitors frequently suffer as a result of the outcome.

The three main types of competition are as follows. Real competition is defined as two of them: interference competition and exploitation competition. Evident competition, a third form, is not. Competition between persons happens directly in interference, whereas it happens indirectly in exploitation and perceived competition.

Therefore, competition is the ideal word to describe the type of interaction between milkweed and maize plants.

Find out more on competition at https://brainly.com/question/15525466

#SPJ1

Nathan Bedford Forest State Park in
Tennessee has been under attack as
a movement to change its name is
underway. Support or refute the
assertion that historical monuments
and parks named after racists
should be removed or renamed.
Defend your view.

Answers

In Tennessee's Benton County, in the southeast of the country, there is a state park called Nathan Bedford Forrest State Park. The park is located on the western side of the Tennessee River's Kentucky Lake impoundment.

What is the Argument About?

There is widespread opposition to the notion that Black Tennessee people, regardless of income, could ever enjoy Nathan Bedford Forrest State Park based on the history of Nathan Bedford Forrest. In the years leading up to the American Civil War, Nathan Bedford Forrest made money through trading slaves. During the Civil War, he committed heinous war crimes, including the murder of hundreds of Black men who had surrendered at Fort Pillow. He founded the Ku Klux Klan and was its first grand wizard, a hateful and racist organization that has tormented and killed Black Americans since its inception.

To know more about Civil War, visit:

https://brainly.com/question/29766424

#SPJ1

Did Genghis Khan promote people within his empire by bribery, merit or who their family was

Answers

Genghis Khan promote people within his empire by merit. The best skills rose to the top because he promoted based on merit.

Who was Genghis Khan?

The Mongol Empire, which grew to be the largest continuous empire in history following Genghis Khan's passing, was founded by him and was led by the first Great Khan.

He attained power by bringing together a number of the nomadic tribes of the Mongol steppe and becoming known as Genghis Khan, the supreme leader of the Mongols.

Genghis Khan, the leader of the Mongols (1162-1227), grew up in obscurity and built the biggest land empire in history. He unified the nomadic tribes of the Mongolian plateau before capturing major portions of China and central Asia.

Therefore, Genghis Khan promote people within his empire by merit. The best skills rose to the top because he promoted based on merit.

To know more about the Genghis Khan, visit:

https://brainly.com/question/1845312

#SPJ1

Named for elephants, this country was a French colony until it received its independence in 1960. Sandbars, some as long as four miles (6.4 km) long, lie along the coast. Many coastal cities have developed in this area where the sandbars or barrier islands are separated from the mainland by narrow lagoons.

What country is being described?

Answers

Answer:

The country being described is Côte d'Ivoire (Ivory Coast). Côte d'Ivoire is a country in West Africa that was a French colony until it received its independence in 1960. It is named for the elephants that were once prevalent in the region and are depicted on the country's coat of arms. The country has a long coastline with sandbars and barrier islands separated from the mainland by narrow lagoons. Many coastal cities, such as Abidjan and Grand-Bassam, have developed in this region.

Explanation:

HURRY
Which of the following is an example of a secondary source?
A documentary on the American Revolution produced by a respected historian
A death certificate of Vietnam soldier
A newspaper article from September 12, 2001 detailing the attacks of September 11th

Answers

Answer:

The correct answer is: A newspaper article from September 12, 2001 detailing the attacks of September 11th

Do you agree that a relationship can be meaningful if based on sincerity and acceptance? Why? Why not? Share a brief narrative about this situation as it happens in your life.

Answers

I agree that a relationship can be meaningful if based on sincerity and acceptance. This is because the abovementioned factors are critical ingredients for building trust and strong social bonds.

What brief narrative may be related to the above?

Examples of where the above may be applicable may be between friends, business partners, and even family members.

In a business relationship, there will be a lot of problems if all the parties involved cannot trust each other. This may eventually lead to the dissolution of the business.

This is one of the big reasons for divorce cases.

Learn more about relationships:
https://brainly.com/question/23752761
#SPJ1

Choose all that apply to the Articles of Confederation:


Choose all that apply to the Articles of Confederation:


Established the Electoral College.


Every state was its own "country."


Could not raise taxes.


Established the United States.


Established a weak central government.


Set up the 3 branched governmental system we have today.

Answers

What applies to the Articles of Confederation are:

Created the Electoral College.Each state was its own "country".Founded the United States.

What is the 3 branch government system like?

The current government system is divided into 3 branches that act to balance government powers. Are they:

LegislativeExecutiveJudiciary

Therefore, the articles of confederation were the first US documents, and the division into 3 branches helps in the control of power by a governmental body and greater autonomy of decisions.

Find out more about Articles of Confederation on:

https://brainly.com/question/13152253

#SPJ1

15. Describe the overall results and significance of the Hundred Years' War.
(Importance)

Answers

Answer: The Hundred Years' War was a series of conflicts fought between England and France from 1337 to 1453. It was a significant period in the history of both countries, and had a lasting impact on the development of their national identities.

The war was sparked by a dispute over the succession to the throne of France, but quickly evolved into a broader conflict over control of territories in France and the status of the English king as a vassal of the French king. The fighting was characterized by long periods of attrition, with neither side able to gain a clear advantage for extended periods of time.

In the end, the English were able to win some important battles and gain control of significant territories in France, including Calais, but they were ultimately unable to hold on to these gains. The war ended with the French victory at the Battle of Castillon in 1453, and the English were forced to renounce their claims to the French throne.

Overall, the Hundred Years' War had a significant impact on the development of both England and France. It strengthened the English monarchy and national identity, and helped to create a sense of English nationalism that would endure for centuries. At the same time, it helped to unify the various regions of France and solidify the French state under the Valois dynasty. The war also had a lasting impact on the art, literature, and culture of both countries, and remains a significant period in the history of Europe.

Explanation:

, which minority group has the greatest need for additional policies from both Congress and the President to promote equity in the 21st century.
Be sure to include the following:
• 2 pieces of evidence (either personal experiences or information acquired from the lesson or any other media)
• Reasoning for each piece of evidence (why is this information relevant? How doe is prove your point?)

Answers

Native Americans have the greatest need for additional policies from both Congress and the President to promote equity in the 21st century.


What is the policies?

A collection of individuals, a commercial organization, a state, or a major organization that has publicly agreed to a set of ideas or a plan of actions to take in specific scenarios.

The minority group in the US is Native Americans. Native Americans are entitled to voting rights, residence, and employment. The status was the same for Americans.

In five critical areas—federal financial support, access to funds, linguistic access, citizen participation, and contract and procurement—the Equity Action Plan prioritizes equity and expands opportunity.

Learn more about policies , Here:

https://brainly.com/question/28024313

#SPJ1

What did the United States pass to help Great Britain economically prior to its entry into World War II?
O the Lend-Lease Acts
O the Selective Service Act
O the Embargo Act
O the Neutrality Act

Answers

The United States passed the Lend-Lease Act to help Great Britain economically prior to its entry into World War II.

What is Legend - Lease Act ?In accordance with the Lend-Lease Act, which Congress passed in March 1941, the President was authorized to "sell, transfer title to, exchange, lease, lend, or otherwise dispose of" weapons and other military supplies to "any country whose defense the President deems vital to the defense of the United States." This effectively allowed the United States to provide aid to Great Britain and other countries fighting against the Axis powers, even before the United States had entered the war. This act was seen as a way to help Great Britain and its allies to fight the war and at the same time also help the US economy by purchasing the materials they needed.All men between the ages of 21 and 45 were required to register for the draft under the Selective Service Act, a statute implemented in 1940, in order to serve in World War II.The Embargo Act, an American statute that forbade the export of specific items to other nations, was passed in 1807.

To know more about Legend - Lease Act , check out :

https://brainly.com/question/1126649

#SPJ1

which is the longest railway station in world

Answers

Answer:

The trans-siberian railway.

Explanation:

connects Moscow with the Russian far east is still the world's longest direct rail route, running for 9,259 kilometers or 5,753 miles. The journey passes through the Ural Mountains, Siberia's birch forests and Lake Baikal, taking 6 days according to The Telegraph.

Answer:

The longest railway station in the world is the Hubli railway station in Karnataka, India with a length of 1,505 metres.

Explanation:

The station, which is also known as the Hubli Junction, is situated in the heart of the city of Hubli and serves as a major transportation hub for the region.

The station is spread over an area of 100 acres and has a total of 12 platforms.

The station is also an important transportation hub for the South Western Railways division of the Indian Railways, with trains from all over India passing through the station on a daily basis.

The Hubli railway station is also known for its cleanliness and modern amenities, good facilities available for the convenience of travelers.

To know more about Railway station,

https://brainly.com/question/14301182

https://brainly.com/question/18816854?referrer=searchResults

PLEASE HELP ASAP WILL GIVE BRAINLIEST

How can identifying your career cluster help you to plan for your career?
It can show you the best possible company to work for.
OIt can show you what type of education might be required.
It can determine your exact future income.
It can match you with a mentor.

Answers

Just an idea. I would answer by stating that the career cluster gives you ideas on future careers based on your interests and passions. Also say that it might not have been the ideal career for you, and was merely just a suggestion.

Which of the following statements accurately describes President Hayes’s reaction to the Great Railroad Strike of 1877?
President Hayes ordered railroad companies and striking workers to resolve their dispute through peaceful negotiations.
President Hayes ordered railroad companies to reverse pay cuts to end the strike.
President Hayes promised railroad workers government subsidies as incentives to return to work.
President Hayes sent militias and federal troops from town to end the strike.

Answers

"President Hayes sent militias and federal troops from town to end the strike" accurately describes President Hayes’s reaction to the Great Railroad Strike of 1877. Option D

What is  President Hayes’s reaction?

Generally, Which of the following assertions most truly characterizes President Hayes' response to the Great Railroad Strike of 1877? To put a stop to the strike, President Hayes sent local militias as well as federal soldiers from the town.

An injunction was issued by the federal government against the union, Debs, and other leaders of the boycott, instructing them to cease interfering with trains that carried postal vehicles. The injunction was secured by the government. Following the refusal of the strikers, President Grover Cleveland issued an order to bring in the army to prevent the strikers from stopping the trains.

In order to reopen the railways, President Rutherford B. Hayes sent federal soldiers to a number of different sites. In the meanwhile, the strike had expanded to a number of other states, including Maryland, where it sparked violence in Baltimore between those participating in the strike and the militia of that state.

Read more about  President Hayes’s

https://brainly.com/question/2500664

#SPJ1

When historians investigate how the Spanish and Portuguese built their empires, they notice

Answers

When historians investigate how the Spanish and Portuguese built their empires, they notice many similarities between how the two countries engaged in this process. Option A

What are the Spanish and Portuguese empires?

Generally, During the Age of Exploration and Conquest, which started in the late 15th century and continued until the late 18th century, Spain and Portugal, respectively, were the countries that governed the lands and colonies that came to be known as the Spanish and Portuguese empires.

The Spanish Empire was one of the greatest empires in world history.

It stretched over four continents, including Europe, North and South America, and parts of Africa and Asia.

The Portuguese Empire was also a very extensive empire, but its primary objective was to colonize Brazil as well as other areas in Africa and Asia.

Read more about the Spanish and Portuguese empires

https://brainly.com/question/8098815

#SPJ1

How much time elapsed between the collapse of the Hittites and the defeat of the Persian empire

Answers

Answer:

1,400 years

Explanation:

The time between the collapse of the Hittites and the defeat of the Persian Empire was approximately 1,400 years. The Hittites collapsed around 1180 BCE, while the Persians were defeated by Alexander the Great in 330 BCE.

a reason that native Americans would fight alongside us or British forces despite the setbacks that both nations had caused their people

Answers

Native Americans had a variety of reasons for fighting alongside the Americans or British. Some Native Americans fought for the British or Americans because they believed that it was in their best interests to do so. For example, they may have believed that aligning with a particular side would help them to protect their land or way of life. Other Native Americans may have fought for the British or Americans because they believed that it was the right thing to do, or because they wanted to protect their families or communities. Still others may have fought for personal or political reasons. It is important to note that Native Americans were not a monolithic group, and they had a wide range of motivations for fighting in wars.

please help!!
1. Describe the nonverbal communication you observed among the six people you chose to focus on. Be sure to include elements of both kinesics and proxemics in your description. How do the nonverbal behaviors differ among people from the two cultural groups you observed? How large a role do you think individual variation plays in explaining differences?
2. Describe the anthropological experiment you did by altering your nonverbal behaviors with people you know. What elements of kinesics or proxemics did you alter in your interactions, and how did your friends or relatives react?
3. The chapter states that differences in nonverbal communication can be a source of miscommunication in cross-cultural interactions. Based on your experience doing this activity, how would you evaluate the role of nonverbal communication in causing such misunderstandings?

Answers

Answer:

1. The nonverbal communication I observed among the six people I chose to focus on included elements of kinesics and proxemics. In terms of kinesics, I noticed that people from both cultural groups used a variety of gestures and facial expressions to communicate their thoughts and feelings. For example, people from both groups smiled, nodded, and used hand gestures to emphasize their points. In terms of proxemics, I noticed that people from both groups stood close to each other when conversing, but there were subtle differences in the amount of space they maintained. People from one group tended to stand a bit farther apart from each other than people from the other group. I think individual variation plays a large role in explaining the differences in nonverbal behaviors between the two cultural groups. Each person has their own unique set of nonverbal cues and behaviors, and these can vary from person to person, even within the same cultural group.

2. For my anthropological experiment, I altered my nonverbal behaviors with people I know by changing my facial expressions, gestures, and posture. For example, instead of smiling and nodding, I would frown and shake my head. I also changed the amount of space I maintained when talking to them. I noticed that my friends and relatives reacted differently to my altered nonverbal behaviors. Some of them seemed confused or even uncomfortable, while others seemed to understand my intentions and responded accordingly.

3. Based on my experience doing this activity, I would evaluate the role of nonverbal communication in causing misunderstandings in cross-cultural interactions as being very important. Nonverbal cues can often convey different meanings across different cultures, and if these cues are not interpreted correctly, it can lead to confusion and miscommunication. Additionally, individual variation in nonverbal behavior can also lead to misunderstandings, as people may interpret the same gesture or expression differently depending on their own experiences and background.

Explanation:

What were some goals of the Fourteen Points? Select each correct answer.
freeing overseas travel from fear of attack
preventing secret treaties between countries
establishing first-world economic dominance
establishing free trade

Answers

Some goals of the Fourteen Points were:

freeing overseas travel from fear of attackpreventing secret treaties between countries

What was the goal of the Fourteen Points ?

The goal of President Woodrow Wilson's 14 Points, delivered in a speech to the United States Congress in January 1918, was to establish a lasting peace after World War I. The points included self-determination for nations, freedom of the seas, free trade, disarmament, and the creation of an international organization to resolve disputes between nations. Wilson believed that by addressing the underlying issues that had led to the war, a lasting peace could be achieved.

In a speech to Congress delivered in January 1918, President Wilson first alluded to the ideas in his Fourteen Points. The Fourteen Points were primarily written by him to express his ideal of post-war peace. Each of the fourteen recommendations outlines a strategy that might help to avert future wars.

Find out more on the Fourteen Points at https://brainly.com/question/25356883

#SPJ1

Please help me. Look at the attached picture.

Answers

The U.S. Constitution grants Congress, the President, and the Federal courts, respectively, this same authority to act as the legislative, executive, and judicial branches of the federal government.

What does the American government's legislative branch do?

The House of Representatives and the Senate, which together make up the United States Congress, encompass the Legislative Branch, which was established by Article I of the Constitution.

Legislative – Creates laws (Congress, comprised of the House of Representatives and Senate) . 100 serve in the U.S. SenateExecutive: Implements laws (president, vice president, Cabinet, most federal agencies) .535 Members of Congress. Judicial—Considers laws (Supreme Court and other courts). 435 serve in the U.S. House of Representatives.

Therefore, There are 535 members of Congress in total. There are 435 members of the U.S. House of Representatives and 100 members of the U.S. Senate.

Learn more about Congress from the given link.

https://brainly.com/question/28800752

#SPJ1

The Mensheviks were known for
Select one:

Their support of developing democracy in Russia.


Being die-hard revolutionaries, no matter what the cost.


Wanting a broad base of popular support for their revolutionary causes.


Only caring about radical change.

Answers

The Mensheviks were known for A. Their support of developing democracy in Russia.

What were the Mensheviks known for ?

The Mensheviks were a faction within the Russian Social Democratic Labour Party (RSDLP) which had a more moderate stance than the other faction, the Bolsheviks. They supported the development of a democratic government in Russia, as well as greater civil liberties and the protection of workers' rights.

They believed that the path to socialism would come through the development of a capitalist economy, democracy, and the education of the working class. They were not revolutionary die-hards, they wanted a broader base of popular support for their causes, and they believed that socialism can only be achieved through peaceful means and with the support of the majority of the population.

Find out more on the Mensheviks at https://brainly.com/question/1001756

#SPJ1

Which statement best describes England’s North American settlement attempts before 1600?
A they did very well. B there were no attempts before 1600 c they all failed. They survived for fifty or more years before giving up

Answers

Answer:

C: They all failed.

Explanation:

England made several attempts to establish settlements in North America before 1600, but all of these attempts failed. The first attempt was the Roanoke Colony, which was established in present-day North Carolina in 1585. The colony was abandoned just three years later, and the fate of the colonists remains a mystery to this day. England made several other attempts to establish colonies in North America in the following years, but all of these attempts also failed. It was not until the founding of Jamestown in 1607 that England was able to establish a permanent settlement in North America that survived for more than a few years.

It refers to the development of personality that resulted in the application of virtues

Answers

The practice that refers to the development of personality such that there was an application of virtues is A. Character.

What is character ?

Character refers to your personality, particularly how trustworthy and honest you are. A person with good character is trustworthy and sincere. They are unreliable and dishonest if they have a negative character.

Virtues are acquired through instruction and application. According to the ancient philosopher Aristotle, self-control is a virtue that can be developed, whereas repeated self-indulgence can destroy a person's character.

This demonstrates that Character refers to the process of personality development that results in the application of virtues.

Find out more on character at https://brainly.com/question/15229018

#SPJ1

The full question is:

It refers to the development of personality that resulted in the application of virtues

A. Character

B. Disposition

C. Values

D. Personal goals

US policy of preventing the spread of communism

Question 1 options:

massive retaliation


mutual assured destruction


Cold War


containment

Answers

US policy of preventing the spread of communism is known as containment. Thus, the correct answer is option D.

What is containment?

The containment doctrine was designed to limit the rise of the Soviet Union and, later, China's influence by preventing the spread of communism throughout the world. George Kennan developed the theoretical principles of containment policy in a 1947 anonymous article.

Kennan's main goal for US policy was to prevent the spread of communism by establishing a network of military alliances. One of Truman's main goals was containment, which resulted in the formation of NATO (1949), ANZUS (1951), SEATO (1954), and CENTO (1955). (1955).

Therefore, to prevent the geographic spread of communism US used the strategy known as containment.

To learn more about containment, click here:

https://brainly.com/question/14089792

#SPJ1

How does the structure of the Taj Mahal reflect the Muslim culture of the Mughal era?

Answers

Answer:

The Taj Mahal is a reflection of the Mughal era's Muslim culture. Its design is based on Islamic architecture, featuring a large central dome surrounded by four smaller domes and four minarets. The structure is decorated with intricate carvings and calligraphy, and is made of white marble. Additionally, the Taj Mahal is a mausoleum, which is a reflection of the Islamic tradition of burying their dead in ornate tombs.

Explanation:

The Taj Mahal is a reflection of the Mughal era's Muslim culture. Its design is based on Islamic architecture, featuring a large central dome surrounded by four smaller domes and four minarets.

The Mughal rule was once the golden age of Muslim structure in India, especially under the reign of Jahangir, Akbar, and Shah Jahan. Muslims introduced to India many kinds of buildings among which was the mausoleum. It is a shape of octagonal structure constructed to accommodate the tomb of a vital man or woman.

The structure is decorated with delicate carvings and calligraphy and is made of white marble. The basic persona of the Taj shows a first-rate integration of architectural factors of Islamic Asia, incorporating Iranian features such as the octagonal shape, the iwan, and pishtaq, and Central Asian details such as the four cylinder-shaped minarets.

In ornamental terms, the construction used to be decorated with the three essential factors of Muslim decorative arts involving calligraphy, geometry, and floral forms shown in the form of frames and borders covering most of the areas.

Overall, the architecture gives a beautiful sense of harmony and vibe between the individual buildings, as well as a feeling of immense peace. The white marble used throughout the Taj Mahal reflects the changing light, allowing a wide variety of colors that lend the whole complex an unreal glow.

To know more about the Architecture of The Taj Mahal, click here:

https://brainly.com/question/2929624

Other Questions
Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10