What enzyme is used in the production of low calorie food and why is it used? No links please x

Answers

Answer 1
The enzyme used is Isomaltulose and it used as an alternative to sugar.

Related Questions

Which mechanism allows lipid-soluble substances to move through the membranes of endothelial cells of capillaries

Answers

Answer:

Diffusion.

Explanation:

The mechanism that allows lipid-soluble substances to move through the membranes of endothelial cells of capillaries is simple diffusion.

Simple diffusion is a passive transport mechanism that allows lipid-soluble substances to move across the membranes of endothelial cells in capillaries. This process occurs down a concentration gradient, from an area of higher concentration to an area of lower concentration, without the need for energy expenditure.

The membranes of endothelial cells, which make up the walls of capillaries, are composed of a lipid bilayer. Lipid-soluble substances, such as oxygen, carbon dioxide, steroid hormones, and certain lipid-soluble drugs, can readily diffuse through this lipid bilayer due to their ability to dissolve in and pass through the hydrophobic interior of the membrane.

Unlike lipid-soluble substances, water-soluble substances, such as ions and polar molecules, are unable to passively diffuse through the lipid bilayer. Instead, they rely on specific transport mechanisms such as facilitated diffusion or active transport to cross the endothelial cell membrane.

In the context of capillaries, simple diffusion allows lipid-soluble substances to move from the bloodstream through the endothelial cell membranes and into surrounding tissues or vice versa. This process plays a crucial role in the exchange of gases, nutrients, and waste products between the bloodstream and the tissues.

It is important to note that while simple diffusion allows for the passage of lipid-soluble substances, the movement of these substances can also be influenced by factors such as concentration gradients, molecular size, solubility, and the presence of transport proteins. However, the primary mechanism by which lipid-soluble substances traverse the endothelial cell membranes of capillaries is through simple diffusion.

To learn more about endothelial cells, here

https://brainly.com/question/31857955
#SPJ2

do prokaryotic cells have membrane bound organelles

Answers

do prokaryotic cells have membrane bound organelles

Answer: No

Explanation : if not mistaken prokaryotic cells have no internal membrane-bound organelles within their cytoplasm , but they do contain ribosomes.

How would the decimal point move to solve the equation 124 ÷ 10 to the power of 1?

Answers

The answer is 12.4 the decimal point will move to the left

Answer the following question number 13 for 20 point

Answers

Answer:

All i could fine is metamorphic rocks

Explanation:

Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids or, more commonly, some combination of these factors. Conditions like these are found deep within the Earth or where tectonic plates meet.

Hoped that helped:P

Answer:

D, or hornfels.

Explanation:

Hornfels is a metamorphic rock formed by the contact between mudstone / shale, or other clay-rich rock, and a hot igneous body, and represents a heat-altered equivalent of the original rock. This process is termed contact metamorphism. It's not like animal metamorphism.

What is gene expression?

A. The production of a trait
B. The reading of DNA
C. Using a protein to make a gene
D. Using a gene to make a protein

Answers

Answer:

it is the process of information encoded in a gene which is used to direct the assembly of a protein molecule.

4. How would having a high blood viscosity affect your ability to climb stairs? Explain your answer interms of homeostasis of oxygen/carbon dioxide levels

Answers

Having a high blood viscosity will slow down ability to climb stairs. This is

because high blood viscosity is associated with high blood pressure.

The binding of oxygen to the blood is reduced in a blood with high viscosity

as there is difficulty in the transport of blood for oxygenation due to its

higher density. This allows fro accumulation of carbon dioxide in the blood

which is harmful to body cells.

High blood viscosity will therefore reduce one's ability to climb stairs and

perform other activities.

Read more about blood viscosity on https://brainly.com/question/8321796

write the main roles of water​

Answers

Answer:

Keeps people's health in order by carrying nutrients and oxygen to cells, Protects humans organs and tissues and Helps to regulate temperature and help the body in many ways. Also, up to 60% of the human body is water.

Hope that helps. x

what are all the decomposers in the ocean?

Answers

Answer:

crustaceans and mollusks, bacteria, fungi, sea cucumbers, starfish, sea urchins, and other kinds of marine worms.

Explanation:

Overall, the main decomposer organisms in marine ecosystems are bacteria. Other important decomposers are fungi, marine worms, echinoderms, crustaceans and mollusks. In the colder ocean waters, only bacteria and fungi do the decomposing because the other creatures cannot survive in the extreme condition

which statement correctly compares a function of lipids to a function of proteins in the body?

Answers

The main role of nucleic acids is to store information that is used to make proteins. Nucleic acids come in two main forms: deoxyribonucleic acids, also known as DNA, and ribonucleic acids, also known as RNA. The main function of DNA is to store the genetic information that cells in the body need to function

which compound is orgaic

Answers

A compound that has Carbon and Hydrogen

Answer: organic compound, any of a large class of chemical compounds in which one or more atoms of carbon are covalently linked to atoms of other elements, most commonly hydrogen, oxygen, or nitrogen. The few carbon-containing compounds not classified as organic include carbides, carbonates, and cyanides.

4. PART B: Which quote from the text best supports the answer to
Part A?
O A "protesting the annexation of Texas as a slave state." (
Paragraph 7)
OB "and launched a newspaper where for 15 years he published
his views." ( Paragraph 8)
OC "his growing prestige gave him resonance in politics" (
Paragraph 9)
D "Douglass opened a dialogue with the president-elect" (
Paragraph 10)

Commonlit = ABOLISHING SLAVERY: THE EFFORTS OF FREDERICK DOUGLASS AND ABRAHAM LINCOLN

Answers

Answer:

C

Explanation:

.

The quote from the text that best supports the answer to Part A is as follows:

"his growing prestige gave him resonance in politics" (Paragraph 9).

Thus, the correct option for this question is C.

What is a Quote?

A quote may be characterized as a sequence of repeating the exact words of a speaker or an author. It is also a passage or statement repeated in this way. Quote means to cite something as a form of proof. The quote has several other senses as a verb and a noun.

According to the context of this question, the quote may be governed by the continuous repetition of a sentence, phrase, or passage from speech or text that someone has said or written.

In oral speech, it is the representation of an utterance (i.e. of something that a speaker actually said) that is introduced by a quotative marker, such as a verb saying.

Therefore, growing prestige gave him resonance in politics is the quote from the text that best supports the answer to Part A. Thus, the correct option for this question is C.

To learn more about Slavery, refer to the link:

https://brainly.com/question/567921

#SPJ2

What is the term used to describe when a molecule moves into the cell through a
transport protein but does not require energy to do so?
a) facilitated diffusion
b) osmosis
c) active transport
d) filtration

What’s the correct answer

Answers

A) facilitated diffusion :)

1
Which of the following is BENEFIT of using natural fertilizer?
O its cost effective (cheap)
O you know exactly what nutrients/minerals are in it
it adds to the soil and makes it better long term
O it could lead to e. coli outbreaks

Answers

The effect of natural fertilization is adds to the soil and make it better long term

Which to provide evaluation of force, posture, and duration for the neck trunk and upper arms coupled with muscle function and physical lose on the body

Answers

Answer:

Strength, reflexes, and eye-hand coordination tend to decrease with a(n)

plant cell don't burst when placed in water because?​

Answers

Answer:

it absorbs the water

Explanation:

what percentage of earth water is found in the oceans

Answers

Answer: 97 percent of earths water is found in the ocean the other percent is fresh water.

Explanation:

Answer:

About 71 percent of the Earth's surface is water-covered and the ocean hold about 96.5 percent of all Earth's water.

ok how do I fix my constipation

Answers

Answer:

Regular exercise for example swimming, walks

Increase the content of fiber in food, choose higher fiber cereals and legumes

Desist from waiting or holding in the urge to defecate

Avoid processed or fast foods, white bread, doughnuts, pastries

Drink more fluids, especially water

Eat more fruits as they help relieve constipation. For those with edible skins, do not peel them as they are rich in fiber

Explanation:

Try this

Answer:

1. Take a fiber supplement

2. Eat a serving of higher-fiber food

3. Drink a glass of water

4. Take a laxative stimulant

what is the specific function of the structure labeled f?

Answers

Answer:

The muscle spindle indicated by F functions as a proprioceptor that is responsive to changes in the length of the surrounding muscle.

Explanation:

The specific function of the structure labeled f is  proprioceptor that is responsive to changes in the length of the surrounding muscle.

What is the function of the muscle spindle?

The muscle spindle is activated whenever the weight of the body, tending to bend the knees, stretches the muscles. Stimuli are sent to the spinal cord and through the motor nerve and the muscles contract to counteract the action of gravity.

The Muscle spindle is a proprioceptive sensory receptor spindle composed of muscle bundle fibers. Its main function is to signal changes in the length of the muscle on which it is located. Muscle Spindles are structures responsible for mechanical myo-integrity and regulation of muscle contraction/distension.

See more about muscle spindle at brainly.com/question/12993297

explain how redox reactions are involved in energy exchanges

Answers

Answer:

In redox reactions, energy is released when an electron loses potential energy as a result of the transfer. Electrons have more potential energy when they are associated with less electronegative atoms (such as C or H), and less potential energy when they are associated with a more electronegative atom (such as O).

tortoise shells and snail shells are similar in function to protect the organism from predators based on a comparison of the organisms in the images what can you conclude

Answers

Answer:It is the fourth option

Explanation:

which of these processes produces gametes in animals?

Answers

Gametes are formed through meiosis (reduction division), in which a germ cell undergoes two fissions, resulting in the production of four gametes.

what would happen to the carrying capacity of the ecosystem & why

Q-a volcano covers an area with 2 feet of lava

Answers

Answer:

The carrying capacity would shoot downward.

Explanation:

The area would no-longer be able to support organisms or the ground until the lava cools off. Even after then, any plants that may have been there will be gone, meaning that the ecosystem can now support less herbivores, as well as less primary producers (plants).

Less plants, means less herbivores, which means less of the animals that eat the herbivores (secondary and tertiary consumers).

some bacteria can digest oil how are these bacteria helpful​

Answers

Answer:

human microbiota

Explanation:

build vitamins and help protect the body from diseases

Microbiota:

the range of microorganisms that may be commensal, symbiotic, or pathogenic found in and on all multicellular organisms, including plants

which structure is not found in both males and females?

Answers

Answer:

Vestibular gland

I hope this helps

Gene regulation is the basis for cellular differentiation and morphogenesis.

True
Or
False

Answers

Answer:

True

Explanation:

1. Why does the angle of the sun at noon seem to change at different months throughout the year?

2. How does this create seasons?

Answers

Answer:

1. The earth orbit is slightly elliptical, and the earth axis is tilted by roughly 23.5° to the orbit. These to factors combine to make the an analemma. But in the winter, When the Earth is on the other side of orbit, the Earth's north pole is tipped away from the Sun, so at noon the sun doesn't get as high.

2. The earth's spin axis is tilted with respect to it's orbital planet. This is what causes the season. When the earth's axis points towards the sun. it is summer for that hemispheres. Midway between these two times in spring and autumn, the spin axis of earth points 90 degrees away from the Sun.

5. What would happen if all of the bird types in this activity flew to an island where no birds had
been before and the only food available was rice? Which birds would be most successful? Which
birds would be least successful?

Answers

Answer:

the birds would either have two choices. they can eithe starve or they could adapt and eat the rice. they eventually would adapt if they wanted to stay alive and thrive or they would simply become extinct

Explanation:

If all of the bird types in this activity flew to an island where no birds had been before and the only food available was rice then they either starve or adapt and eat the rice.

What is adaptation?

An adaptation can be defined as the heritable behavioral, morphological, or physiological trait which has evolved through the process of natural selection of a species, and maintains or increases the fitness of an organism of a species under a given set of environmental conditions and time.

In this activity, if all of the bird types flew to an island where no birds had been before and the only food available was rice then they either starve or they could adapt and eat the rice. However, they eventually would adapt if they wanted to stay alive on that island and thrive or they would simply become extinct.

Learn more about Adaptation here:

https://brainly.com/question/29768035?

#SPJ2

Illustrate the following with the help of suitable diagrams.
a) Binary fission in Amoeba
b) Binary fission in Leishmania
c) Multiple fission in plasmodium
d) Regeneration in Planaria
e) Budding in Hydra
f) Spore formation in Rhizopus

Answers

Answer:

D. Regeneration in Planaria

Explanation:

If it is divided into 3 parts a, b and c, each part grows as a new individual

*Fill in the blank*

The biological molecule ____ usually makes up enzymes. Enzymes are used to ____ ____ the rate of a reaction within an organism. Each enzyme has a special shape called an ____ ____ where a ____ binds to break down into different products.

The enzyme can keep breaking down millions of substrates because it is ____ If an enzyme’s environment changes, it will not work effectively because the ____ of the active site changes. This change is called ____.

Words : site, | up | substrate | protein | denaturation | shape | reusable. | speed | active

Answers

Answer:

protein, speed up, active site, substrate, reusable, shape, denaturation

Explanation:

The biological molecule _protein usually makes up enzymes. Enzymes are used to _speed _up the rate of a reaction within an organism. Each enzyme has a special shape called an _active _site where a _substrate binds to break down into different products.

The enzyme can keep breaking down millions of substrates because it is _reuable If an enzyme’s environment changes, it will not work effectively because the _shape of the active site changes. This change is called _denaturation.

Fill in the blanks.

The biological molecule is a numerous substance that makes up the cells and living organisms. Has a wide range of sizes and structures. The enzyme is a substance that performed the works of a catalyst in living and regulates the chemical reactions.

Hence the answer protein, speed up, active site, substrate, reusable, shape, denaturation.

The biological molecules that makeup up the enzymes are known as protein, helps to speed up, the rate of the reactions within the organisms, and lead to the special shape known as an active site. There a substrate binds the break down into various products.The enzyme can be broken down into millions of parts and due to they are able to reusable and can change their shapes, the change in the enzymes is called denaturation.

Learn more about the fill-in-the-blank.

brainly.com/question/2624765.

Although all organelles of the eukaryotic cell interact with each other within the cell to maintain homeostasis, the mitochondrion has a unique evolutionary history. It is proposed that this organelle originated as an engulfed aerobic bacterial cell that lived in a symbiotic relationship with its host cell. This explanation for the origin of the mitochondria can be supported by multiple lines of evidence. Select ALL statements that could provide accurate support for the theory of endosymbiosis as it relates to the mitochondrion. A) Mitochondria have multiple membrane layers. B) Mitochondria are the largest and most numerous organelle in the cell. C) Mitochondria have their own ribosomes separate from the ribosomes in the cell. D) Mitochondria have their own DNA that resembles the circular chromosome of bacteria. Eliminate E) Mitochondria have the ability to control when the cell undergoes mitosis or exits the cell cycle.

Answers

Answer:

A

C

D

Are correct

Hope it helps

Other Questions
which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please