you---- write to your mother every week since she missed you too much
a.better b.better had c.should d.ought​

Answers

Answer 1

Answer:

A.Better

Explanation:

Better in this sentence is referred to the word must or "have to" therefore, the correct grammar is indeed A.


Related Questions

Read this excerpt from a passage.

Robots have been around longer than many people realize. Archytas, who lived in Greece over 2,300 years ago, is believed to have created the first robot. Archytas built a steam-powered mechanical bird that was able to flap its wings and fly over 200 yards. However, it was not until the late 1700s, with the beginning of the Industrial Revolution, that the world saw the large-scale use of more complex machines. Mechanization took another leap during the 1930s, when machines were introduced into many workplaces in order to increase productivity. Instead of hiring workers to perform tasks on an assembly line, factory owners used automated machines that could do the work of several people.

Then, in 1954, George Devol created the Unimate, a robotic arm. The Unimate began working on the assembly line at General Motors in 1961, taking on unpleasant, dangerous, and repetitive tasks. This robotic worker had many advantages over human workers. The Unimate did not require a salary, followed company rules, and never called in sick (although it did require the occasional repair). In addition, the Unimate could work twenty-four hours a day, seven days a week. Manufacturers that used the Unimate and other industrial robots saw a marked increase in productivity and a decrease in labor costs.



What features show this is an example of historical writing?

a.
It uses primary research that is based on the scientific method.

b.
It explains, outlines, and analyzes current trends.

c.
It focuses on the causes and consequences of certain events.

d.
It relies on anecdotes, examples, and testimonies as evidence.

Answers

The text presents an example of historical writing focusing on the causes and consequences of certain events, as shown in option C.

We can arrive at this answer because:

Historical writing shows events from the past and the situations that made up those events.In the case of the text shown in the question above, the author shows events from the past, the causes, and the consequences that these events had on the development of machines and robots.

In this case, when the author relates elements of the present with the primordial elements of their creation, citing events from the past, he is showing an example of historical writing.

More information about historical writing at the link:

https://brainly.com/question/375608

In the lecture, we reviewed the reading process and how we can use this process to increase our comprehension and understanding of what we’re reading. The reading process involves many active reading steps, such as questioning, surveying, taking notes, and reflecting/recalling. For your initial post complete the following: Share your experience with a time when you had to read some challenging material. This material could be personal, professional, or academic in nature. Explain why you had to read the material and what made it particularly challenging. Also, tell what the outcome of the reading was. For example, did you eventually get the information you needed to get out of it? Did you have to ask for help or clarification? Did you make a mistake which affected the outcome of the situation? After sharing the outcome, share one skill you learned about through learning about the reading process that would have improved your outcome in the situation you shared.

Answers

The above question requires a personal answer about your reading experience, for that reason, I can't write an answer for you, but I'll show you how to do it.

It is common that we have to read difficult texts, which need to be read thoroughly and with a strategy that helps us to understand. Based on this, you should search your memory for a time when you had difficulty reading and understanding a text.

After remembering that moment, you can write your answer as follows:

Introduce the characteristics of the text that you might have difficulty reading.Introduce why you felt difficult.Show the techniques you used to make the text easier to read and increase your comprehension of the text.Show if these techniques were effective.Show your mistakes when trying to understand the text.Show what you learned from it.

More information on reading techniques at the link:

https://brainly.com/question/13096385

1. In a scale of 1-10, how would you rate the skill of Lin Dan? Why?​

Answers

Answer:

Utiliser l'échelle d'un plan ou d'une carte

L'échelle d'un plan ou d'une carte est le rapport entre les mesures des distances reportées sur la carte ou le plan et les mesures des distances réelles. Ce rapport est constant et concerne l'ensemble des objets et des longueurs présents sur la carte ou le plan. En fait, il s'agit d'un rapport de proportionnalité. Attention : l'échelle n'a pas d'unité.

Explanation:

Utiliser l'échelle d'un plan ou d'une carte

L'échelle d'un plan ou d'une carte est le rapport entre les mesures des distances reportées sur la carte ou le plan et les mesures des distances réelles. Ce rapport est constant et concerne l'ensemble des objets et des longueurs présents sur la carte ou le plan. En fait, il s'agit d'un rapport de proportionnalité. Attention : l'échelle n'a pas d'unité.

When footwear has greater traction, what does this mean?

Answers

Answer:

It means it gives the shoe less rotation.

Explanation:

Rotational traction refers to the traction that resists rotation of the shoe during pivoting movements. For the athlete, high rotational traction equates to a greater tendency for foot fixation during changes of direction and low rotational traction means the shoe tends to release from the surface more easily.

Answer:

It mean how much fricton you have on the bottom of your foot or shoes to keep you on something or connect something to a wall of some sort

Explanation:

which statement contains characterization?

Answers

Explanation:

Direct Characterization tells the audience what the personality of the character is. Example: “The patient boy and quiet girl were both well mannered and did not disobey their mother.” Explanation: The author is directly telling the audience the personality of these two children.

Answer the question.

Answers

There’s no poem to go off of so here’s my guess I think the main theme of the poem is language and communication/ love
So say like
Percy's conversation with Poseidon bring them together because in the passage blah blah says “insert and quote” this affects there relation ship because it shows the main theme is language and communication/ love

Should driving while talking on a cell phone be illegal? I wish to comment on the recent ordinance passed by City Council that bans the use of cell phones while driving. First of all, driving while talking on the phone is dangerous because these distracted drivers cause accidents. Secondly, it is annoying to drive behind a person talking on the phone because they do not pay attention. As a result, they may drive too slow or not move at the intersection when the light changes. Furthermore, cell phones are not allowed on airplanes. Why should a car be any different? We should all be proud of our city leaders for addressing this problem. What is the purpose of this letter? Select one: a. Persuade Correct b. Inform c. Explain a process d. Analyze

Answers

Answer:

I think the answer is to persuade.

might be to inform as well.

Explanation:

I think it is to persuade because the author asks the question "why should a car be any different?"  as to let the readers imagination run with it.

I also think it may be to inform because the author says "driving while talking on the phone is dangerous" so the author could be saying I don't think its a good idea to have a phone in the car and this is why.

I could be wrong but that is what I think

I _____ since my childhood​

Answers

I lived since my childhood

What does it put away ???

Answers

The meaning of the word put away means to discard or do away with something.

What is the meaning of the word "put away"?

The word put away is a transitive verb that implies that we renounce, discard or do away with someone or something that we believe is either of no use or purpose to us any longer.

The word put away can be used in sentences as:

After dinner, Zafirah helped put away the leftovers and wash the plates.The teacher had to put away the old test files when he was promoted to the school headmaster.

Learn more about the meaning of the word "put away" here:

https://brainly.com/question/12642211

she is bearing many more children by forgetting her health status ( Into passive ) ​

Answers

Answer:

Many more children are beared by her forgetting her health status

Explanation:

Which word from this passage most clearly disrupts the mood?
The horned beast prowled the dungeon, stamping its feet and shaking its fluffy mane, ready to devour a victim.

a. beast
b. dungeon
c. fluffy
d. devour

Answers

Answer:
B

Explanation:

Answer: Its C Fluffy

Explanation: Got it righ

Which reason does the author give for presenting the
false dilemma that people should either own a dog or
no pet at all?
O Dogs are superior to all other animals as pets.
O Dogs are more reliant on their owners than other
pets.
O People who own dogs are more mature than people
who own other pets.
O People who own dogs are more knowledgeable than
those who own other pets.

Answers

False dilemma is a type of fallacy which is used when a speaker wants to narrow down options by making one option seem like the best and absolute and no other choices are available.

I don't know the passage where your questions comes from, ut the use of false dilemma would probably say something like, "Dogs are the most important pets to have" which limits the other pets which a person can have.

With this in mind, this is fallacious and is not true at all. So I would advise you to read the text again, carefully and note where the writer used words which limits the choice of other pets other than dogs and that is probably your answer.

Please note that your question is incomplete so I gave you a general overview so that you could better understand the concept.

Read more about false dilemma here:

https://brainly.com/question/7392929

Which of these quotes most accurately explains the meaning of the following statement to Banquo?

Answers

Answer:

The Thane of Cawdor deceived and betrayed the king

Explanation:

NO LINKS NO LINKS

Are blue light glasses good for your eyes
Only answer if you know
Explain also whyy

Answers

Answer:

Blue light blocking glasses can help reduce eye strain although blue light can adversely affect your eyes by making it difficult to focus on the screen, hence your eyes will strain to concentrate. Furthermore, Blue light glasses help to increase contrast on your screen therefore making it easier to focus and subsequently reduce the eye strain one would have had as stated earlier.

Explanation:

What other 2 ways did ancient Egyptians used lapis lazuli... other than on king tuts eyebrows?

Answers

l

[tex]{ \mathcal{a}}nswer[/tex]

Lapis Lazuli and Ultramarine Blue

Ancient Egyptians used it to create blue cosmetics. In the Renaissance, painters ground the stone to make ultramarine, a blue pigment used for skies and seas. Michelangelo used lapis lazuli powder for the blue colors in his frescoes for the Sistine Chapel.

NEED MORE HELP ASAP!!!

Answers

number 5 is C number 6 is C and number 7 is B number 8 is C number 9 is is A

I watched the timer counting down. My stomach rumbled I was hungry. I tapped my foot impatiently my food still wasn’t ready. A delicious smell filled the air I heard satisfying popping sounds my mouth watered. The microwave beeped I yanked open the door. I stuffed the popcorn into my mouth.



1. Copy the paragraph into the text box. Rewrite the paragraph so there are no run-ons, but here’s the catch: you have to follow these rules!

Add at least three conjunctions like “and,” “so,” or “because.”
Add no more than two periods.
Add commas where necessary.
When you add or change punctuation, make sure you capitalize letters correctly!

Answers

Answer: i like ur avater ur cute 12 first copy

Explanation:  would you want to have with me ayooo ayooo

Summarize this short text for the most relevant information:

The 2 main areas of agreement of the Glasgow climate pact
Developing countries
The agreement pledged to significantly increase money to help poor countries cope with the effects of climate change and make the switch to clean energy.
There's also the prospect of a trillion dollar a year fund from 2025 - after a previous pledge for richer countries to provide $100bn (£72bn) a year by 2020 was missed.
While some observers say the COP26 agreement represented the "start of a breakthrough", some African and Latin American countries felt not enough progress was made.



Fossil fuel subsidies
World leaders agreed to phase-out subsidies that artificially lower the price of coal, oil, or natural gas.
However, no firm dates have been set.

Answers

Answer:

This text was about the struggles of gas, oil, and coal prices. Many world leaders agreed to lower the price, some observers say this could be the start of a breakthrough. Prices are raised to help poor countries with climate change so they could switch to clean energy.

Tell me if it's argumentative or informative for each question

Answers

Answer: 1 = informative

2= argumentative

3= argumentative

4= informative

5= informative

Explanation:

Answer: 1 info 2 info 3 arg 4 info 5 arg

Explanation:

What are some characteristics for consequences?

Answers

Answer:

Robert Louis Stevenson had something interesting to say about this:

Everybody, sooner or later, sits down to a banquet of consequences.

In other words, consequences aren't just for the guilty, they're for everybody. Our actions will, eventually come home to roost in the form of consequences : We will get what. ??

Explanation:

Hope this helps !!

What is the relationship between decisions and consequences?

Answers

Answer:

decisions are something you have to choose or decided on, While consequences are something that reflect from your actions.

Explanation:

Which sentence would make the BEST thesis statement for a persuasive essay on recycling?
A)
Recycling is beneficial to the environment.
B)
Most towns have some type of recycling program,
C)
My community recycles plastic, glass and aluminim cans.
D)
My family recycles more aluminum cans than glass each week.

Answers

I think A would be the best for a persuasive essay

Answer: A. Recycling is beneficial to the enviroment

A persuasive essay is to not inform but to convince the reader to action. Hence the name, "persuasive."

Nick is reading an article about satellite communications and learned thatground-based communication signals are converted first into a microwave signal. Upon knowing that radio waves are also used in telecommunications, he decided to send a text message to his friend, Michael about this knowledge. After composing the text message, he sent it to his friend’s number. After a minute, an incoming message flashed across his cell phone’s screen. The message read: "your text has not been delivered at the moment."

Guided Questions:

1. Why do you think Nick’s text message was not delivered?

2. What other factors may have caused delays in delivering text messages?
3. What do you think is the role of telecommunications company in the delivery of information?​

Answers

The message was not delivered because there was a problem in the process of converting the text message into microwave signals. This process might be affected by other factors such as the receiver turning off the device or the content being unsuitable. Finally, the company has an important role in regulating the delivery process.

As Nick learned sending a text message or any other content from one device to another is a complex process that involves converting the content into waves.

This implies that if the content is not properly converted or something fails in this process, then,  the message will not be properly delivered.

This might be the cause Nick could not send the message to his friend. However, there are other factors such as:

The receiver turning off the phone: This will cause the content not to be delivered immediately.The content is unsuitable: Text messages usually have a limited number of words and complex content such as images, videos, etc. cannot be normally delivered.

Finally, the telecommunications company has an important role because its objective is to avoid any complications in the delivery process.

Learn more about message in: https://brainly.com/question/11223140

please paraphrase this sentence.

and as we know that humans are the main cause of environmental pollution and cause a lot of damage to the earth and living organisms

Answers

Answer:

and as we know that humans are the main cause of environmental pollution and cause a lot of damage to the earth and living organisms

Explanation:

Jill coloured her drawings .... than Daisy but Paola coloured hers

Answers

Answer:

sorry I didn't know this answer

Okay so, I know I've already asked something like this but this time it's a question for my growth mindset class,

--> brainiest = best answer
--> points 100 (50 for each)
--> Question:

Let's say you want to memorize meanings of words, okay? Which option would be the best and fastest? Explain in two sentences. (At least.)

a) Looking over the definitions until you get it.
b) Making tools to help you.
c) Testing yourself until you get all of them correct.
d) (Write your own.)

Second Question:

How do you study for a spelling test? Let's say it's due tomorrow. (Opinion)

a) Keep writing down the words until you get them correct.
b) Making tools to help you.
c) Memorizing the spelling.
d) (Write your own.)

Please answer this for me!!! <3

Answers

Answer:

#1 & #2

Explanation:

For both I would write notes like the term and the definition because I remember things easier when I write it down.

How to an email about your ideas for a day out

Answers

Answer:

Organize your request.

Write an approachable subject line.

Begin with a formal salutation.

Express your request.

Include benefits for the recipient.

Conclude with a call to action

Focus on the recipient.

brainiest please

Explanation:

Ms. Trowbridge will receive a 40% discount off her first cell phone bill. Her monthly cell phone plan charges a flat monthly fee of $25. 00 plus $0. 20 per minute. If ms. Trowbridge talks on her cell phone for 300 minutes during the first month of cell phone service, what will be the amount of her first cell phone bill?.

Answers

Answer:20

Explanation:

i can do a lot of math its rediculus

Give one reason why fibre is good for you

A. It is a source of nutrients

B. It helps to regulate cholesterol
levels

C. It is one of the main food groups

D. It is low in fat

Answers

Answer: b

Explanation:

Begin reading your sources and taking notes. Find enough information to fill at least four note cards. You will need enough information to write a 400-word report. Use the note card format given in the lesson “Report Writing: Researching.”

Answers

Answer:

plz wait few minutes, I'll answer u

Other Questions
A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology. (PHOTOGRAPHY) Rebecca is planning to take photographs on her trip to see the California redwoods. The California redwoods are very, very large trees. She wants to make sure that everyone who sees her photographs understand how giant the trees are. What might she do to help her audience see the scale of the redwoods?Group of answer choicesAsk her parents to park their car near the base of the tree so that it will be in the photograph, too.Take a closeup of the trees bark so viewers get a sense of the level of detail the tree has.Take a photo with more than one redwood tree in the frame.Position herself so that she captures the sky and clouds behind the redwood tree.PLEASE HELP ASAP if the telephone was invented in 1876 how old was it in 1991 how long had it been around 5. My classmate will ask questions to our teacher nor plz help me..In my town, the Chinese Cultural Center offers language lessons on Saturday mornings from 9 to noon. My parents were born in China, but I wasnt. My parents were educated in a Chinese language called Mandarin, but I go to a school where we all speak English. As a result, my family worries that even if we speak Chinese together at home (and we usually do), I might not truly understand our culture or learn how to read or write enough Chinese characters to be literate and fluent.The narrator's parentsI. were born in ChinaII. spoke Mandarin at schoolIII. never learned EnglishAI onlyBII onlyCI and II onlyDI, II, and III In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction Divide 63.5 0.25 round the quotient to the nearest ten-thousandth PLZZZZZZZZZ HELPABC Order and Definitions1.React2.Shift3.Specify4.Thesis5.audience6.format7.purpose8.introduction9.focus10.conclusion11.influence12.fleeting13.mentorship14.normal15.participate16.positive17.circumstantial18.emotional19.contagion20.fleetingABC Order and DefinitionsWrite down 45 affixes containing the sufffix:-or-ment-ness 1/3 of 3 please help I'll give 20 points You want to be able to withdraw $30,000 from your account each year for 15 years after you retire. If you expect to retire in 25 years and your account earns 6.4% interest while saving for retirement and 5.6% interest while retired:Round your answers to the nearest cent as needed.a) How much will you need to have when you retire?$ 448,704.35 (correct answer) b) How much will you need to deposit each month until retirement to achieve your retirement goals?c) How much did you deposit into you retirement account?d) How much did you receive in payments during retirement?e) How much of the money you received was interest? Jacob sells lemonade at a park. His cost to sell the lemonade is a one-time fee for the table,plus a fixed cost to make each cup of lemonade. The line shows the total cost, y, for 3 cupsof lemonade.vCost of Selling LemonadeUseyAy605040Cost ($)302010 X01050203040Number of Cups