The last time Aiden played baseball, he hit the ball 35% of the times he was at bat. Based on this information, how many times will Aiden hit the ball the next time he plays baseball if he is at bat 20 times?

Answers

Answer 1

Answer:

the number of times  will Aiden hit the ball is 7

Step-by-step explanation:

The computation of the number of times will Aiden hit the ball is shown below:

She hit 35% of the times

i.e.

= Given percentage of number of times

= 35% of 20

= 35 ÷ 100 × 20

= 0.35 × 20

= 7

Hence, the number of times  will Aiden hit the ball is 7

We simply applied the above formula so that the correct value could come

The same is to be considered


Related Questions

A manufacturer claims that the mean lifetime of its lithium batteries is 1200 hours. A homeowner selects 25 of these batteries and finds the mean lifetime to be 1180 hours with a standard deviation of 80 hours. Test the manufacturer's claim. Use ΅ = 0.05. Round the test statistic to the nearest thousandth.

Answers

Answer:

Since p is > α we fail to reject the Null as the result is not significant at α = 0.05

Step-by-step explanation:

Given that:

Mean lifetime (m) = 1200

Sample size (n) = 25

Sample mean (x) = 1180

Standard deviation (s) = 80

α = 0.05

The null hypothesis :

H0 : m = 1200

Alternative hypothesis : m ≠1200

The t statistic :

(x - m) / (s/√n)

(1180 - 1200) / (80 / √25)

-20 / (80/5)

= - 1.250

P value = 0.10565 ( p value calculator)

Reject Null hypothesis if p > α

At α = 0.05

Since p is > α we fail to reject the Null as the result is not significant at α = 0.05

Write the first four terms of sequence Rule:start at 28.6, subtract 3.1

Answers

28.6, 25.5, 22.4, 19.3... hope this helps!!

Solve the system of equations:

3x-3y = -15
and
-x+y = 5

Answers

Answer:

x=0 y=5

trust me I think its right

Which graph represents a proportional relationship?

Answers

Answer:

If the relationship between two quantities is a proportional relationship, this relationship can be represented by the graph of a straight line through the origin with a slope equal to the unit rate. For each point (x, y) on the graph, ž is equal to k, where k is the unit rate. The point (1, k) is a point on the graph.

if f(x)=3x-1 find f(2)

pls show steps I rlly need to understand this!

Answers

f(2)=3(2)-1
f(2)=6-1
f(2)=5

Abbas is two years younger than Brad. Two years ago, the sum of their ages was the same as Brad's current age. How old are the boys now?

Answers

Answer:

I believe they are younger

Step-by-step explanation:

I hope this helps

What is 70% of 900
Pls answer quickly

Answers

Answer:

630

Step-by-step explanation:

10% of 900 is 90 (900÷10)

20% of 900 is 180 (90×2)     -     basically the 10% times 2

50% of 900 is 450 (900÷2)

450+180=630         -          the sum of the 20% and 50%

Which is the function represented by the table ?

Answers

Answer:

its b

Step-by-step explanation:

What is the slope-intercept equation for the line below?
(5, 4)
(0, 2)

Answers

Answer:

=  

2/5x +2

Step-by-step explanation:

let me know if im wrong

hope it helps :)

Answer:

A. y=2/5x +2

step-by-step explanation:

hope this helped :-)

What is the weight of 2 apples? *
.12
.24
16.67
8.33

Answers

Answer:

0.24

Step-by-step explanation:

Have a wonderful day <3

Answer the question in the picture. Thanks!

Answers

Answer:

4+3x=9

Step-by-step explanation:

All of the other choices equal to 4x+12=9 except 4+3x.

how do u solve this​

Answers

isolate the absolute value equation -

add 9 to other side to get 16

divide 16 by 4 to get 4

then you get l-3b + 5l is less than 4

now subtract 5 from both sides

then divide by -3 (which flips the sign)

answer: b is greater than 1/3

What is the quotient of -3/8 And -1/3?​

Answers

Answer:

[tex]\frac{9}{8}[/tex]

Step-by-step explanation:

Lets look at this in a more simple way!

[tex]-\frac{3}{8}[/tex] ÷ [tex]-\frac{1}{3}[/tex]

Now we can convert division into multiplication and flip the 1 and 3 numbers (in the fraction "[tex]-\frac{1}{3}[/tex]") all the way around and switch their roles as dividend and divisor:

[tex]-\frac{3}{8}[/tex] × [tex]-\frac {3} {1}[/tex]

Now multiply

[tex]\frac{9}{8}[/tex]

And THAT is your quotient of [tex]-\frac{3}{8}[/tex] ÷ [tex]-\frac{1}{3}[/tex].

Hope this helps!

Have a nice day!

If you find my answer helpful

Pls consider marking my answer as Brainliest! It would mean a lot!

PLA HELP ME 100 POINTS FOR TO ANSWER
The slope of a line is 2. The y-intercept of the line is –6. Which statements accurately describe how to graph the
function?
O Locate the ordered pair (0, -6). From that point on the graph, move up 2, right 1 to locate the next ordered pair or
the line. Draw a line through the two points.
O Locate the ordered pair (0, -6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on
the line. Draw a line through the two points.
O Locate the ordered pair (-6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on
the line. Draw a line through the two points.
O Locate the ordered pair (-6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on
the line. Draw a line through the two points.

Answers

Answer: A

Step-by-step explanation: e2020

Answer:

one

Step-by-step explanation:

abel has $10. he buys a hotdogs for $2,and then he buys 5 bags of chips. if he has no money left, what was the cost of each bag

Answers

Answer:

$1.6

Step-by-step explanation:

do 10-2 then you do 8 dived by 5

Answer:

The cost of each bag is $1.6 according to my calculations.

Step-by-step explanation:

25 points
Write an equation in slope intercept form
(-3,0) (2,1)

Answers

Answer:

y = 1/5x + 3/5

Step-by-step explanation:

Find the remaining zeros of f using the given information about the polynomial.

Then write the linear factorization of the polynomial. Degree 4;
zeros: 3i, square root {7}

Answers

Answer:

noloce necesito puntos

Bdbdjekdmfmfmfkfmf help

Answers

Answer:

Green box: 9

Step-by-step explanation:

7/7 x 9/10

1 x 9/10 = 9/10

A dyadic angle is an angle that is a sum of principle dyadic angles, this is to say that its measure in radians is zero or 2(pi) x (m/(2^n)) for some of the natural numbers m and n. Show that the sum and average of two dyadic angles is again a dyadic angle.

Answers

Answer:

attached below

Step-by-step explanation:

A dyadic angle is the sum of two principal dyadic angles

lets assume P and Q to be dyadic angles also assuming that they are non-zero in Radians

attached below is the proof that sum and average of two dyadic angles is a dyadic angle

If 8 is an element in the domain of ​f(x)=
8x−18
5​, what is the corresponding element in the​ range?

Answers

In Functions and Function Notation, we were introduced to the concepts of domain and range. In this section, we will practice determining domains and ranges for specific functions. Keep in mind that, in determining domains and ranges, we need to consider what is physically possible or meaningful in real-world examples, such as tickets sales and year in the horror movie example above. We also need to consider what is mathematically permitted. For example, we cannot include any input value that leads us to take an even root of a negative number if the domain and range consist of real numbers. Or in a function expressed as a formula, we cannot include any input value in the domain that would lead us to divide by 0.

Find the slope of the line passing through the points (-2, 8) and (3,8).
Please help!!

Answers

Answer:

y=8

Step-by-step explanation:

(-2,8) (3,8)

x,y. x,y

y2-y1/X2-X1=

8-(8)= 0

3-(-2)= 5

since the two points have 8 in the Y space the line would be equal to y= 8

Find the total surface area of this cone,
Round to the nearest tenth.

6cm
4cm
[?] cm2

Answers

Answer:

125.7cm²

Step-by-step explanation:

Given parameters:

Slant height, L = 6cm

Base radius  = 4cm

Unknown:

Total surface area = ?

Solution:

To find the total surface area, we use the expression;

      Surface area = [tex]\pi[/tex]r² + [tex]\pi[/tex]rL  

Now insert the parameters and solve

   Surface area = [tex]\pi[/tex]r(r + L )

    Surface area  =  [tex]\pi[/tex] x 4 (4 + 6) = 3.142 x 4 x 10  = 125.7cm²

A. What is the area of square ABCD?

B. What is the area of square EFGH?

C. What is the area of the unshaded region of ABCD.

NEED HELP!!!!
Not very good with these kinds of problems

Answers

I got you. Answered on a picture

a nursery owner buys 9 panes of glass to fix some damage to his greenhouse the 9 panes cost 19.35 unfortunately he breaks 4 more panes while repairing the garage. what is the cost of another 4 panes?

Answers

Answer:

First we divide 19.35 by 9 to find how much it costs for 1 pane, 19.35/9=2.15$.

Then we multiply by 4 to get the cost of 4 panes, 2.15*4=8.60$. The cost of another 4 panes is 8.60$.

If y is directly proportional with x and y=24 when x=6. What is the value of x when y=16

Answers

Answer:

x = 4

Step-by-step explanation:

Given y is directly proportional to x then the equation relating them is

y = kx ← k is the constant of proportion

To find k use the condition y = 24 when x = 6 , then

24 = 6k ( divide both sides by 6 )

4 = k

y = 4x ← equation of proportion

When y = 16, then

16 = 4x ( divide both sides by 4 )

4 = x

Translate the number equation into a written equation: 2p + 4 = 20

Answers

Answer:

p is 8

Step-by-step explanation:

4 - 20

then 2 divided by 16

then you get 8

Answer:11. g. 10. 3g. 12. 2p. 4q. 20 g plus 10 is the same as. Twice p plus 4 times q is 20. 3 times g. 13. 4(a b). 9a. 14. 8.

Step-by-step explanation:

i think thats the answer

A banner needs to be enlarged from its original format. The dimensions of the original are 4 cm tall by 25 cm wide.The enlarged banner needs to be at least 8 cm wide but no more than 1.4 m tall. Calculate the minimum and maximum ratios of enlargement possible.


Please help me it’s emergency please

Answers

Hope this helps you!

Please help meeeeeeee

Answers

I agree with the person who answered above

please help please answer surely please​

Answers

Answer:

C. 48 m

Step-by-step explanation:

The two vertical sides add up to be (8*2) m = 16m.

The two horizontal sides can be added up to (14*2) m = 28m.

(The top horizontal side can be found by pushing the line in the middle up to the level of the other two portions of the same side.)

Finally, add the leftover two sides (2*2) m = 4m.

16+28+4 = 48.

Hope this helped!

Answer:

C-48

Step-by-step explanation:

hi , you need to fill in the blanks and then add them all together

Classify each function as linear or nonlinear.

Answers

Step-by-step explanation:

Linear:

4x - y = 3

-6x = 3y - 17

x = y/5

non linear:

(x/2)^2 + 1 = y

y/x^2 = 4

2x^2 = 12 - 8y

Other Questions
Which of the following benefits do member of Congress not receive?retirementsalaryimmunity from arrestallowance (6th grade math) yasiara has 3/4 of cake. she wants to divide it up into 1/12 size pieces. how many pieces will she have? ( can you show work please) Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason