What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer 1

Answer:

what I don't understand what is the Ctcagt


Related Questions

What should scientist do after completing a scientific investigation

Answers

Answer:

confirm the results if you're using edge

Explanation:

Answer:

B. confirm the results

Explanation:

i just took it

the egg of an animal is most like which part of a plant

Answers

Answer:

It is the seed of a plant because both have to break open to start a life. Hope this helps please reward brainlist.

Which equations are used to calculate the velocity of a wave?

Answers

Answer:

The Wave Equation

Multiplying the wave's frequency by its wavelength, which is its physical length, yields the velocity of the wave.

Explanation:

Answer:

Just v = f × λ

v is the wavespeed in m/s, f is the frequency (Hz) and λ is the wavelength (m)

Draw a flow chart that explains how DNA is used to create an organism. please use the words: DNA, gene, protein, cell, tissue, organ, organism.

Answers

Answer:

Please find the flowchart attached as an image

Explanation:

DNA is the genetic material contained in the cells of living organisms. The DNA contains a segment called GENE, which contains information used to produce useful products needed in the cell. The information contained in the gene is expressed to produce PROTEINS.

PROTEINS are responsible for many metabolic activities that occurs in a cell. The CELL functions due to activities of the proteins produced by gene expression. When similar cells come together, they form TISSUES. An aggregation of tissues performing similar functions form ORGAN. Organs functioning similarly come together to form ORGAN SYSTEM. A collection of organ systems in the body forms the ORGANISM.

what cause asexual reproduction ​

Answers

Answer:

It is a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes.

The offspring that are produced by asexual reproduction from a single cell or from a multicellular organism inherit the genes of that parent and thus have the sane identical identities of the parent.

What do cells contain?

Answers

Answer:

cells consists of cytoplasm enclosed within a membrane, which contains many biomolecules such as protiens and nucleic acids.

How does weathering affect Earth's surface?

Answers

Answer:

Weathering can wear away any exposed surface on earth over time. It can cause rough surfaces to become smooth, much like a tumbler smooths a rock. An obvious example of weathering is the change of the landscape at the sea. The tides can cause the beach to become smaller or larger.

Explanation:

Answer:

Weathering is the breaking down or dissolving of rocks and minerals on Earths surface.

Explanation:

Once a rock has been broken down, a process called erosion transports the bits of rock and minerals away. ... Weathering and erosion constantly change the rocky landscape of Earth. Weathering wears away exposed surfaces over time.

What causes the differences in physical characteristics like hair color among people?

different versions of genes
variations in DNA length
different numbers of chromosomes
variations in cell nucleus size

Answers

Answer:

The answer is A. different versions of genes

Answer:

A

Explanation:

Different versions of genes

please help me with this question:)

Answers

the answer is a golgi body

i dont know the answer to this please help

Answers

Answer:

b is the correct answer

whatever the answer is look it up

A structure that looks the same and does the same job but was not present in a common ancestor is termed:______.

Answers

Answer:

The correct answer is - analogous.

Explanation:

Analogous structures or organs are the structures with the same look which is developed to perform the same job and not present because inherited by a common ancestor.

These structures are present in unrelated organisms and look the same from outside and perform the same action for example wings of bat and birds look and perform the same action but not inherited from a common ancestor.

Which of the following IS found in a bacteria cell?

Answers

A procaryotic cell has five essential structural components: a nucleoid (DNA), ribosomes, cell membrane, cell wall, and some sort of surface layer, which may or may not be an inherent part of the wall.

From how many stem cells does cell division take place in meiosis?

Answers

Answer:

They probably divide to make EITHER two stem cells, OR two more specialized cells.

Explanation:

What is inside a seed?

Answers

Answer:

inside a seed is a plant called the embryo

Explanation:

if u need more information msg me but i hope  this helped u

Answer:

inside the seed will be a tiny plant cell called the embryo

Which of the following questions would BEST
determine whether a plant is undergoing the
Calvin cycle?
A. Is NADPH being produced?
B. Is oxygen being produced?
C. Is glucose being produced?
D. Is ATP being produced?

Answers

Answer:

C

Explanation:

Glucose is the end result of the calvin cycle. It is not Oxygen, NADPH, or ATP because those are produced in the light reactions.

Is glucose being produced? is the question which will best determine

whether a plant is undergoing the Calvin cycle.

The Calvin cycle is known s the light independent or dark reaction which

takes place during the process of photosynthesis by plants. The final

product for this cycle is Glucose.

Other compounds such as NADPH, ATP and oxygen are all formed during

the light dependent reactions which is why asking if glucose is produced is

the most appropriate choice.

Read more on https://brainly.com/question/920840

name six harmful substance in food production

Answers

Answer:

Expired food and drugs; expired food and drinks that has stayed beyond the appropriate time

Impure water; impure water is dirty water that is not fit for the body system

Unripe fruits; fruits that is not yet due for...

Infested food

Poorly cooked food

Cigarette

Explanation:

Herbicides, pesticides, and chemical fertilizers are some examples, but sterilizing chemicals and preservatives can potentially be harmful if not used properly.

(e) Describe the role a non-competitive inhibitor would play in the ability of enolase to perform
properly.

Answers

Answer:

it would not allow enolase to perform properly because it will bind to it and change its shape not allowing 2-phosphoglycerate to bind to it and convert to phosphoenolpyruvate. this is because it is non-competitive which means there is no way that the molecule could bind to the enzyme.

hope this helped!

T/F In passive transport, substances move from areas of low concentration to
areas of high
A.True
B.False

Answers

Answer:

false

Explanation:

they move from high to low concentration

This illustration shows a kind of animal that is a free-living organism.

What is the common name of the group that contains this organism?

flatworms

tapeworms

cnidarians

annelids

Answers

Answer:

Gotta picture? That would help... Cause it says there's an illustration or something... But either way I just looked it up and found an illustration and the illustration showed a wormy lookin' thing and that wormy lookin' thing look like a flat worm. So I'ma say A. Flat worm. Tall me if I'm wrong! Thanks!

Answer:

Answer. This illustration shows a kind of animal that is a free-living organism. Phylum ( Platyhelminthes ) term is the common name of this organism. The phylum is either free-living or parasitic

Explanation:

When you and your friends work together to find a solution to a project you are:
o mediating
o competing
o cooperating
o assisting

Answers

Answer:

Cooperating

Explanation:

Cooperation is "the process of working together" so if you and your friends are working together, you are cooperating. Hope this helps! :)

Answer:

c

Explanation:

Calculate the force needed to cause a 6 kg bowling ball to accelerate 20 m/s2.

Answers

Answer:

Explanation:

F = m * a

m = 6 kg

a = 20 m/s^2

F = 6 * 20

F = 120 N   which is short for Newtons.

Which of the following would a lipid most likely do in the body?

А. provide quick energy for exercise

B. store genetic information

С. build muscle tissue

D. store energy for later use

Answers

Answer:

D

Explanation:

Lipids have a carboxyl group at one end, a methane group at the other, and a long hydrocarbon chain in between. This structure makes it suitable for long-term energy storage. Quick energy is usually provided by carbohydrates. Nucleic acids store genetic information, and muscle tissue is made up of muscle cells.

The most likely function of a lipid in the body is the storage of energy for later use. Choice D.

Although, lipids are a good source of energy with about 9kcal of energy supplied per gram.

Lipid metabolism to provide quick energy is quite a slow process as opposed to carbohydrates which provide quick energy for exercise and other tasks.

Nucleic acids are responsible for storing genetic information.

Muscle tissues are built by muscle cells.

As lipids are a high energy yielding source, lipids are responsible for storing energy for later use.

Read more:

https://brainly.in/question/27050111

These are some of the factors that drive ocean currents.


ATides, Water, Gyres, Boats
BFish, Water, Temperature, Waves
CGyres, Temperature, Wind, The Moon
DPeople, Fish, Water, Wind


Answers

D: People, fish, water, and wind

The Channichthyidae fish, also known as the

crocodile ice fish, lives in the Southern Ocean

around Antarctica. These waters are known to

maintain extremely low temperatures all year,

ranging from approximately 28°F to 35°F. These fish

have adaptations that allow them to live in cold, low

oxygen waters. (a) If you were to examine the

membrane lipid composition of cells from the

Channichthyidae fish identify what you would

expect to find. (b) Justify why you might find what

you identified in part (a).

Answers

A) If you were to examine the membrane lipid composition of cells from the Channichthyidae fish, what you would expect to find is glycoprotein,zona pellucida protein and a less number of haemoglobin that is found in this type of fish.

B) Justification of why you might find what was identified in part (A) is because;

Glycoprotein contains antifreeze compounds,these antifreeze compounds are what provide resistance to freezing of their hypoosmotic tissues by the subzero environment.

If we analyzed the lipid composition of these fish, we could find glycoproteins.

We can arrive at this answer because:

Glycoproteins are formed by a chain of oligosaccharides, linked to a chain of polypeptides, which are side chain lipids.These glycoproteins have different functions in the body.One of the most important functions is keeping the heat.This function allows heat to remain longer in an organism and heat loss to be slower.

In this case, the glycoprotein is an essential molecule in the organism of living beings that live in environments with very low temperatures, such as fish Channichthyidae.

More information:

https://brainly.com/question/1594163?referrer=searchResults

please help!!!!!!!!!!!!!!!
*A simple circuit is created with one pathway, one battery, one light bulb, and one switch. Why does the bulb go out when you open the switch?
a. Because the battery dies.
b. Because opening the switch opens. the circuit.
C. Because too much electricity flows
through the bulb.
d. Because there is too much voltage.​

Answers

Answer:

The Answer is B.

Explanation:

Answer:

the correct answer is B.

Explanation:

brainliest? Im so close to leveling up.

The largest mass extinction was in the
a. Precambrian time.
b. Cenozoic era.
C. Paleozoic era.
d. Mesozoic era.

Answers

Answer:

♡ hi fairy ♡

- Mesozoic, I just learned about this! it's so sad but it did help our society.

have a great day! hope i could help.

~madeline

✧・゚: *✧・゚:・゚✧*:・゚✧・゚: *✧・゚:・゚✧*:・゚✧

Explanation:

The largest mass extinction was in the: C. Paleozoic era.

The Paleozoic era is simply referred to as the earliest time of the three (3) geologic eras during the Phanerozoic era.

Generally, there are six (6) geologic periods in the Paleozoic era and they are listed from the youngest to oldest as;

The Permian.The Carboniferous.The Devonian.The Silurian.The Ordovician.The Cambrian.

Some of the activities that took place between the start and end of the Paleozoic era time scale include;

I. In the early period of the Paleozoic era (The Cambrian), there were marine living organisms called phyla.

II. During the Paleozoic era, volcanic activities were experienced.

III. The Paleozoic era was prone to erosion and deposition of marine fossils.

IV. Lastly, the Paleozoic era was characterized by the largest mass extinction.

Read more: https://brainly.com/question/6560461

If the same base pairs are used to code for all organisms, why is there so much variation among organisms?


A. The order of the codons differs between organisms

B. The order of the codons is the same between organisms

C. The codons in each organism are the same

D. The codons in each organism differ​

Answers

Answer:

The correct answer would be, A

The order of the codons differs between organisms.

Explanation:

I took the biology test and got this answer correct.

Please mark brainliest if this helped you!

Answer:

A.)

The order of the codons differs between organisms.

Explanation:

EDGE2021

Please answer
Answer answer answer answer answer answer answer

Answers

Answer:

The nucleus is like the principal of a school, the cell membrane is like a school building, and the mitochondria is like the staff in a school.

Explanation:

Definitions:

The nucleus of a cell contains the majority of the cell's genetic material, and coordinates cell activities like protein synthesis and cell division.The cell membrane is the semipermeable membrane of a cell that surrounds the cytoplasm (the material inside the cell other than the nucleus).The mitochondria is "the powerhouse of the cell", because it produces most of the chemical energy needed to power the cell's chemical reactions.

The nucleus is like the principal of a school: the nucleus controls the cell, much like how the principal controls the school.

The cell membrane is like a school building: the cell membrane forms a boundary between the cell and outside environment, much like how the school building separates you from outside.

The mitochondria is like the staff in a school: the mitochondria powers the cell, much like how the staff in a school keep the school running.

Answer:

Answer

Explanation:

Answer

help pls how to i do this, also whats the answer

Answers

Answer:

move 3 to the first 2 form last

Explanation:

Digestion and breathing are _____. controlled by ganglia and plexus reflexive actions controlled by the spinal cord voluntary actions controlled by the central nervous sytem

Answers

Answer:

The correct answer is - reflexive actions controlled by the spinal cord.

Explanation:

Digestion and breathing are examples of involuntary action which is controlled by the autonomic nervous system of the CNS. however, the part of the nervous system that controls is the spinal cord and hind brain by the spinal reflex actions.

These are the action they do not require any thought and work without any thought that leaves the brain for other actions and coordinations. specific but the same stimuli causes the response in the same way.

Other Questions
Lystrosaurus provided which type of evidence supporting continental drift?land featuresfossil evidenceglacial evidenceclimate change evidence What is the x-intercept of the line described by the equation? 14x - 8y = 56 A number times 7 is at least the number plus 6.6.Write the inequality. to convert measurements in the metric system you can move the decimal point left or right why does this work? Which phase consistently has the least number of cell in that phase? Helpppppppppppppp Ill mark u What was the foreign policy that Woodrow Wilson adopted in 1913 as the president?NEED ASAPSelect one:a. He applied a moral standard and refused to recognize any government that is undemocratic or hostile to U.S. interests.b. He applied a moral standard and punished unscrupulous businesses.c. He applied a moral standard and threatened to wage war against U.S.S.R.d. He applied a moral standard and sent missionaries to U.S. partners. What is an electromagnetic wave?A. An induced electric currentB. Vibrating electric and magnetic fields C. Oscillating electric currentD. An electromagnet Rick owns a rectangular lot that is 52.3 m long and 85.62 m wide. How manymeters of fencing material does he need? HELP NEEDED ASAP IM CONFUSED Write an equation of the line shown. Then use the equation to find the value of x when y=150 16. Like the U.S. Constitution,GA's Constitution has athat list the rights ofthe people that the governmentcan't takeaway. Deon has $600 in his saving accountHe spends $15 per month on Netflix He spends $5 per month in HuluIf he does not make any more purchases, select all of the months that he can continue to have the subscription before he goes into debt. The elements of design can be thought of as building blocks for a work of art.TrueFalse Please help! What does the term Industrial Revolution refer to? A) an overthrow of factory owners B) a period in time when there was significant change in the way goods were manufactured C) a union protest D) the organization of a reform movement resulting in war between industrial cities what factors led to increased demand for minerals after the civil war ? Which aspect of the U.S. Constitution shows the influence of Montesquieu on the Founding Fathers? Dee spends $0.25, $0.30, $0.10 and $0.04.How much $ does she spend in all? Choose the correct answer below for the following problem:(489) + (764) = A. 1,253 B. 275 C. 1,253 D. 275 Barney, a manager, is very conventional, resistant to change, habitual, and does not accept new ideas very easily.This implies that Barney has:________.A) low neuroticism.B) low customary thinking.C) high extraversion.D) high agreeableness.E) low openness to experience.