Pls help Im stuck brainliest and 5 star rating !!!!!!!!!!!!!!!!! :::::::::::)))))

Pls Help Im Stuck Brainliest And 5 Star Rating !!!!!!!!!!!!!!!!! :::::::::::)))))

Answers

Answer 1
I am going from left to right.
11, 20, 31, 13, 35, 100

Related Questions

A 15% tip on a restaurant bill is $3.60. How much is the bill?

A. $12.60
B. $18.60
C. $24.00
D. $54.00​

Answers

The answer is C
3.60 x 100/ 15
360/15
24

The cost of bill is,

⇒ $24

What is mean by Percentage?

A number or ratio that can be expressed as a fraction of 100 or a relative value indicating hundredth part of any quantity is called percentage.

To Calculate the percent of a number , divide the number by whole number and multiply by 100.

Given that;

A 15% tip on a restaurant bill is $3.60.

Now,

Let the cost of bill is, $x

Hence, We can formulate;

⇒ 15% of x = 3.60

⇒ 15x/100 = 3.60

⇒ 15x = 360

⇒ x = 360 / 15

⇒ x = 24

Thus, The cost of bill is, $24

Learn more about the percent visit:

https://brainly.com/question/24877689

#SPJ2

A new espresso coffee maker is being used at the coffee shop where you work. It heats water to 122°F in a matter of seconds. What is the equivalent
Celsius reading of this temperature?

Answers

Answer:

50°C

Step-by-step explanation:

(122°F − 32) × 5/9 = 50°C

Can you guys help me with this problem

It is the picture

Answers

Answer:

Mulipte them

Step-by-step explanation:

for the 15 ft look at the other side which is 50 ft  and do 50-15 to see what is the other missing part

A quadrilateral has vertices at (1.4).
(7,3), (3, -5), and (8,4). The
quadrilateral is dilated by a scale
factor of 3.5 with the origin as its
center. What are the coordinates of
the vertices of the image of the
quadrilateral?

Answers

Given:

A quadrilateral has vertices at (1,4), (7,3), (3, -5), and (8,4).

The quadrilateral is dilated by a scale factor of 3.5 with the origin as its center.

To find:

The coordinates of the vertices of the image of the quadrilateral.

Solution:

If a figure is dilated by a scale factor k with origin as it center, then

[tex](x,y)\to (kx,ky)[/tex]

It is given that the quadrilateral is dilated by a scale factor of 3.5 with the origin as its center. So, the rule of dilation is

[tex](x,y)\to (3.5x,3.5y)[/tex]

Using this rule, we get

[tex](1,4)\to (3.5(1),3.5(4))[/tex]

[tex](1,4)\to (3.5,14)[/tex]

Similarly,

[tex](7,3)\to (3.5(7),3.5(3))[/tex]

[tex](7,3)\to (24.5,10.5)[/tex]

[tex](3,-5)\to (3.5(3),3.5(-5))[/tex]

[tex](3,-5)\to (10.5,-17.5)[/tex]

And,

[tex](8,4)\to (3.5(8),3.5(4))[/tex]

[tex](8,4)\to (28,14)[/tex]

Therefore, the coordinates of the vertices of the image of the quadrilateral are (3.5,14), (24.5,10.5), (10.5,-17.5), (28,14).

Hmm which one? Need it asap and will gift brainlest for answer

Answers

Answer:

divide 47.12 by 3.14

Step-by-step explanation:

that way it will give you an answe

is it A or B right answer get brainiest​

Answers

Answer:

a

Step-by-step explanation:

Nobody noticed my last questions please answer them though .

Answers

Answer:

28 degrees

Step-by-step explanation:

just subtract 62 from 90

Which statement is true of z11.7?
z11.7 is between 0 and 1 standard deviations of the mean.

z11.7 is between 1 and 2 standard deviations of the mean.

z11.7 is between 2 and 3 standard deviations of the mean.

Answers

Answer

z11.7 is between 1 and 2 standard deviations of the mean.

Step-by-step explanation:

Marissa works in a bread shop every hour

Answers

Answer:

She's getting paid minimum wage, in debt, and struggling in college.

Derek bought cups for $50 a dozen. He sold them for $10 each. What is his profit?

Answers

$70 is the profit because 12x10=120 then 120-50

Step-by-step explanation:

no loss because he bought so rich and sold so los cost

What is the slope of the line?

Answers

The slope is 3/4 or 0.75

Answer:

-1

Step-by-step explanation:

Substitute the two points given into the slope formula:

m= y2-y1/x2-x1

m= 0-1/1-0

m=-1

The Slope is -1

Hope this helps! :)

I hat number is one hundred more than 292

Answers

Answer:

I assume you mean "what" number is

Step-by-step explanation:

your answer would be 100 + 292

Therefore Answer = 392

Please mark my answer as the brainliest for further answers :)

Answer:

No

Step-by-step explanation:

one hundred isn't more than 292 it's less than 292.

HELP please please will give brainly

Answers

Answer:

1: x int = (-7,0)

y int = (0,-7)

2: x int = (4,0)

y int = (0,8)

Step-by-step explanation:

Just use a website called desmos. Simply your equation then plug it in.

I need help again /:

Answers

Step-by-step explanation:

I would go with a or b but one sec let me work it out

Tell me the definitions of the following vocabulary words:



quadrilateral:



parallelogram


trapeze:



rectangle:



diamond:



square: PLS HELP ME

Answers

Answer:

quadrilateral: a four-sided shape or figure and has four striaght sides

parallelogram: four-sided plane with oppisite paraell sides

trapezoid: a quadrilateral with one pair of parell sides  

rectangle: a figure with both four stright and four right angles. It is also quadrilateral, paraellagram,  

diamond: a quadrilateral that has four sides of the same lenght and is also a parallelogram .

square: a quadrilateral with four equal sides. It is a rectangle and parallagram.

Hope that helped you! :)

Step-by-step explanation:

Please helP I WILL MARK BRAINLIEST!

Answers

Answer:

believe it's G, I hope that's correct for you

what is 7432 divided by 6

Answers

1238.6 and a line over the 6 because it’s continuing

BRAINLIEST
a. 45
b. 34
c. 29
d. 56​​

Answers

B. 34 is the correct answer for that problem. Hope this helps :)

Helpppppppppppppppppppppppppppppppppppppppppppppppppppppppp

Answers

Answer:

147

Step-by-step explanation:

Answer:

x= 147

Step-by-step explanation:

x+33°= 180° (sum of angles on a straight line)

x= 180°-33°

x= 147°

Solution or not a solution

and because

Answers

Step-by-step explanation:

X + Y = -3

X + 3x +5 = -3

X=-2

X+Y=-3

Y=-3+2

Y=-1

Type the 4 letter code , need before one please :)

Answers

9514 1404 393

Answer:

  DECB

Step-by-step explanation:

Correct except for graph 2. That graph has a solid line, a y-intercept of -2 and a slope of 4. Its inequality is ...

  y ≤ 4x -2 . . . . choice E

sorry that the pic is upside down
ANSWER IT PLS
NO LINKS​

Answers

the answers to that question is 75 degreey

help i'll give you a brainliest pls :)

Answers

Answer:

17%..................

Which simplified expression matches the perimeter of the shape?

Answers

2 (4+5) + 2 (2 + 3)
hope it helps


Function m represents the number of people in a movie theatre on a Tuesday as a
function of hours since the movie theatre opened.

Here is the graph of function

Based on the graph and the situation, what are the domain and range for function m?

The domain is...

The range is...

Answers

the domain is [0, 14] and the range is [0, 85]

I need this answer as soon as possible and also can u explain it

Answers

Answer:

56

Step-by-step explanation:

x=5

so x for the gym is 5 and x+3=5+3=8

add 5 and 8 because that is a whole side.

we are trying to find perimeter which us the outside of the shape. you are just going to "walk the fence" . so now, we have two sides of 15 and two sides of 13 (5+8). 13+13=26. 15+15=30

add the 26 and 30

How to find area when perimeter is given?

Answers

Put formula of perimeter and simplify to get value of any variable ,

Then replace the value of that variable in formula of area and then simplify it .

Can Sombody answer this?

Answers

Answer:

x = √3

Step-by-step explanation:

tan 30° = 1/x

x = 1.73

but to get it in radical form:

sin 30° = 1/hypotenuse

hypotenuse = 2

x² = 2²- 1² = 4 - 1 = 3

x = √3

The table shown below represents a function. Which of the following values cannot be used to complete the table?
X Y
-10 5
-25 10
-5 15
__ 20

1. -20
2. -15
3. -5

Answers

Answer:

3.-5 is correct

Step-by-step explanation:

We are given,

The table which represents a function.

Now, 'A function is a relation in which every element of the domain has a unique image'.

So, from the table, we see that,

-5 has the image 15.

So, it cannot have another image.

Thus, the number which cannot be used to complete the table is -5.

Hence, option C is correct.

A cohort study of smoking and lung cancer was conducted in a small island population. There were a total of 1,000 people in the study, and the study was conducted over a ten year period. Four hundred were smokers and 600 were not. Of the smokers, fifty developed lung cancer. Of the non-smokers, 10 developed lung cancer. In order to measure the strength of association between smoking and lung cancer in this population, which measure of exposure-disease association would you use

Answers

Answer:

A measure of exposure-disease association one could use is the odds ratio (OR)

Step-by-step explanation:

An Odds ratio (OR) is a statistical measure quantifying the level of association between two events such as an exposure and an outcome

The odds ratio gives the probability of outcome where there is a given amount of exposure

We have the table;

[tex]\begin{array}{ccc}&Developed \ lung \ cancer& Did \ not \ develop \ lung \ cancer\\Smokers&50&350\\Non-smokers&10&590\end{array}[/tex]

The odds ratio = (The number of smokers with the lung-cancer)/(The number of non-smokers with lung-cancer) ÷ (The number of smokers smokers without long cancer).(The number of non-smokers without long cancer)

∴ OR = (50/10) ÷ (350/590) = 59/7 = 8.[tex]\overline{428571}[/tex] ≈ 8.4

Therefore, a smoker is approximately 8.4 times more likely to develop lung cancer than a non-smoker.

Other Questions
What theorem is being applied if two triangles of one triangle are congruent to two angles of another triangle and the triangles are similar? Which details develop the central idea that the leaders believe? which system supports sales forecasting? a. personnel information systems b. marketing information systems c. financial information systems d. logistics information systems A playground is in the shape of a rectangle. The length of the rectangle is three times its width. The area of the playground is 19,500 square feet. What is the length of the playground? Round to the nearest foot. Hint: use A=LW Please write in the correct adjective.1. Mi hermano es __________(fat).2. Mis abuelos son _______(strong). 3. La hija es muy _______ (pretty).4. Mi esposo y yo somos ___________ (smart).5. Yo soy ______________ (burnette).6. Yo estoy ____________(busy).7. Nosotras estamos __________(sad). In the figure below, R is between Q and S, and S is between R and T. If QS = 12, RT=9, and QT=17, find RS. Name the main layers of a tropical rain forest. What kinds of plants grow in eachlayer? Please select the word from the list that best fits the definitionIllegitimate power that is achieved by force or the threat of force. Describe and correct the error in solving the equation This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI