Identify explain how the issue that required the Missouri Compromise was evidence of growing sectionalism in the United States.

Answers

Answer 1

Answer:

The Missouri Compromise created a temporary bandage to keep the Union together. The issue of slavery first became a major issue during these disputes. Slavery will continue to be an issue in the Union for years to come. During this time, the sectionalism between the North and South was increasing, and the issue of expansion of slavery is tearing apart the country. The expansion of slavery angered the North, and the abolitionists were more radical. The South viewed slavery as not morally wrong, they would do whatever it took to continue slavery, even if it meant seccession.

Explanation:


Related Questions

Which excerpt from “1859 Autobiographical Statement for the Chester County Times” is an example of Lincoln’s sarcasm? “We reached our new home about the time the State came in the Union. It was a wild region, with many bears and other wild animals still in the woods.” “If a straggler supposed to understand latin, happened to sojourn in the neighborhood, he was looked upon as a wizzard.” “I was raised to farm work, which I continued till I was twenty two. At twenty one I came to Illinois, and passed the first year in Illinois-Macon county.” “I was losing interest in politics, when the repeal of the Missouri Compromise aroused me again. What I have done since then is pretty well known.”

Answers

Answer:

A

Explanation:

what the soul of america is about?

Answers

Answer:

America was founded on Christian principals, but it was also founded out of a battle against tyranny. America was built out of the threat of tyranny, so it's government hindered the development such a threat. Though, the system was set up for a christian people and was described as "wholly inadequate for an immoral people."

American girl yuyyy is the best thing I have to say I love you too I don’t think I can get it done lol I love love y’all bye love bye hi hello hi hi bye hi hi hello hi bye hi hello hi buddy hey hey hi buddy hi bye hi hello hi bye hi buddy hey buddy bye

Question 1
Part A: What can you conclude from the text?
The narrator is unsure about who she loves
The narrator is fighting for her life.
The narrator struggles with giving her life for the one she loves.
O The narrator is unable to choose.

Answers

Answer:no idea

Explanation:

Elizabeth I (1533–1603)
Elizabeth, I ruled England for more than 40 years, a reign so influential that it is known as the Elizabethan Age. Her mother was beheaded when Elizabeth was only two years old, and her stepsister, Mary I, accused Elizabeth of treason and had her imprisoned in 1554. Perhaps as a result of these events, Elizabeth’s great talents were caution and strategic thinking. When the 25-year-old Elizabeth assumed the throne, she quickly moved to unify her country. She made it clear that Protestantism would be the religion of England. Through taxes she replenished the treasury. She never married, though she had many suitors. She cautiously avoided European wars, but when her diplomatic games led the Spanish Armada to invade, her navy famously stopped them in the English Channel.
More About the Image: The original of this painting of Elizabeth I is attributed to George Gower. It was painted in oil on a wooden panel, around 1588, to commemorate the defeat of the Spanish Armada.

1. Making Inferences In what ways do you think the events during Elizabeth’s youth molded her character?




2. Interpreting Significance Queen Elizabeth’s refusal to marry was a controversial political decision at the time. Why? Why might Elizabeth have chosen to remain single?

Answers

Answer:

1) Making Inferences In what ways do you think the events during Elizabeth’s youth molded her character?

- Although these events somewhat traumatized the Princess, they also molded her into a strong, independent personality.

Explanation:

2) Interpreting Significance Queen Elizabeth’s refusal to marry was a controversial political decision at the time. Why? Why might Elizabeth have chosen to remain single?

- Because there could not be a queen in a monarchy before a country without a king, it was necessary if or if (male chauvinism of the time). Moreover, Elizabeth decided not to marry anyone, because her greatest wish was to be committed to her country, to be loved and respected by its inhabitants/citizens; and to reign on the throne of England until the day she died.

What was the mission of the song El Deguello and cannon aide all day and night?

Answers

The Degüello (Spanish: El toque a degüello) is a bugle call, notable in the US for its use as a march by Mexican Army buglers during the 1836 Siege and Battle of the Alamo[1] to signal that the defenders of the garrison would receive no quarter by the attacking Mexican Army under General Antonio López de Santa Anna.

Which of the following 19th-century groups would have most disagreed with
the opinion James Madison expressed in "Who Are the Best Keepers of the
People's Liberties?"

Answers

Answer:

D. Members of the Whig Party

Explanation:

Answer:

D. Members of the Whig Party.

Explanation:

Took the test.

Which document expresses that people are entitled to the free exercise of religion?
A.
the English Bill of Rights
B.
the Mayflower Compact
C.
the Virginia Declaration of Rights
D.
the Fundamental Orders of Connecticut


SOMEBODY HELP PLEASE!!!

Answers

Answer:

c

Explanation:

The Virginia Declaration of Rights

The Virginia Declaration of Rights expresses that people are entitled to the free exercise of religion. This answer has been confirmed as correct and helpful.

SOLVE BY ELIMINATION PLEASE HELP I'LL GIVE BRAINLIEST I AM CONFUSED WITH THIS

Answers

Answer:

x=1

y=2

Explanation:

..............

hello pls help QUICK thank you! where was the Continental Congress

and what deligates and decision were made?

Answers

Answer:

Philadelphia

Explanation:

Read this passage. It takes place just after Alfonso has promised to take Sandra riding, but he’s broken his bike chain. At four he decided to get it over with and started walking to Sandra's house, trudging slowly, as if he were waist-deep in water. Shame colored his face. How could he disappoint his first date? She would probably laugh. —“Broken Chain,” Gary Soto What evidence from the passage supports the theme “People often care about what others think of them”? Alfonso deciding to go out with Sandra Alfonso worrying that Sandra will laugh Alfonso being angry at himself for blushing

Answers

Answer:

B edge 2020

Explanation:

Answer:

Alfonso worrying that Sandra will laugh

Explanation:

Why was Europe afraid of the Ottoman Empire?

Answers

Andre fight his battle against to your hobbies and chill

How did Sam Houston die?

Answers

Answer:

After leaving office, Houston returned to his home in Galveston. He later settled in Huntsville, Texas, where he lived in a structure known as the Steamboat House. In the midst of the Civil War, Houston was shunned by many Texas leaders, though he continued to correspond with Confederate officer Ashbel Smith and Texas governor Francis Lubbock. His son, Sam Houston, Jr., served in the Confederate army during the Civil War, but returned home after being wounded at the Battle of Shiloh. Houston's health suffered a precipitous decline in April 1863, and he died on July 26, 1863, at 70 years of age. He died due to health issues.

Why did the Greeks develop myths?

Answers

Answer:

I'm pretty sure it was to stop the younger generation from doing bad things. it was like a scare tactic

Why did the government not trust Socrates?

Answers

Answer:

Greece Democracy

Explanation:

Conservative Republicans and Democrats disagreed with government involvement in the New Deal because they thought states should regulate their own affairs. the government should raise taxes even more the government should spend more than it had businesses were not being regulated enough​

Answers

There were conservative Republicans and Democrats in the New Deal who were against government involvement because they thought states should regulate their own affairs.

Why were conservatives opposed to the New Deal?

Conservatism in the United States has always been associated with the belief that states should have more say in their affairs.

As a result, conservatives in both the Republican and Democrat parties were opposed to the New Deal because they felt that it took away powers of the state government.

Find out more on the New Deal at https://brainly.com/question/1188384.

#SPJ2

Answer:

I think the answer would be A. States should regulate their own affairs

Explanation:

I think it would be this because I got it right when I took the test, my reasoning was because they didn't want to involve themselves with other peoples problems, regulating their own affairs would allow them to do this without worrying about it being unconstitutional.

Did the United States live up to the ideals of justice and democracy during WWII ? Explain why.

Answers

Answer:

No they did not

Explanation:

Democracy is when the whole country, peacefully, comes to agreements about issues through elected officals. During the civil war, the states were split up fighting against each other over the issue of slavery. This does not at all represent democracy. Slaves were still being kept during the time of WWII which is a huge injustice and inequality.

Which of the following statements is FALSE? a. When William Travis gave the men at the Alamo a chance to leave, over 180 men stayed despite almost certain death. b. The Mexican government had no real political need to take the Alamo, but Santa Anna wanted to get revenge for the defeat of General Cós and teach the Texas rebels a lesson. c. Santa Anna’s ruthless treatment of the Texas rebels ended at Goliad where General Urrea defied his orders to massacre over 350 captured Texans. d. Santa Anna’s army spent two weeks at the Alamo, which gave Texans at the Convention of 1836 time to declare independence and write a constitution.

Answers

Answer:

the answer is B.

The Mexican government had no real political need to take the Alamo, but Santa Anna wanted to get revenge for the defeat of General Cós and teach the Texas rebels a lesson.

hope this helps

Answer:

B

Explanation:

For how many years did the Crusades last?

Answers

Answer:

From 1095-1291 so roughly 196 years!

Explanation:

In American democracy, why is the principle of checks and balances important?


Minority rights are protected


No one branch can have too much power


Representative government is guaranteed


Elections are fair and free

Answers

Answer: No one branch can have too much power

Explanation: There are 3 branches in the US government, and they all check their power with checks and balances.

What inspired the natives to fight for independence the most? Why?

Answers

Answer:

Most Native American tribes during the War of 1812 sided with British because they wanted to safeguard their tribal lands, and hoped a British victory would relieve the unrelenting pressure they were experiencing from U.S. settlers who wanted to push further into Native American lands in southern Canada and in the lower Great Lakes and the south. Although some tribes remained neutral and some supported the United States, the majority allied with Britain.

Explanation:

Freedom, Bec their land Wht not fight for it.

What was the purpose of the Fort Laramie Treaty with the Sioux?

A. to prevent further battles with the Sioux
B. to collect taxes from the Sioux
C. to build a road in Sioux land to gold-mining areas
D. to obtain complete government control over the Sioux

Answers

Answer:

In the spring of 1868 a conference was held at Fort Laramie, in present day Wyoming, that resulted in a treaty with the Sioux. This treaty was to bring peace between the whites and the Sioux who agreed to settle within the Black Hills reservation in the Dakota Territory.

Explanation:

So (A) is your answer


Why did Lewis and Clark temporarily separate on their return trip?

A. They were preparing to attack a hostile tribe.
B. They were avoiding hostile tribes.
C. They were trying to locate the source of the Missouri River.
D.
They were trying to determine the quickest route to reach the Yellowstone River.
E.
They had disagreed over the method to be used for mapping.

Answers

The Answer would be D.
The answer to that would be A.

Who is the only Democratic candidate to win Texas in a Presidential Election?
A kennedy B carter C Obama D gore

Answers

Answer:

Jimmy Carter

Explanation:

Ford wasn't favorable as he pardoned Jimmy Carter this was seen by most Americans as a deal made so as to win presidency and the media was strongly against him also the economy was inflated. That most likely cause the swing for Texas.

Explain how the system of checks and balances makes sure that no one branch of government gets too powerful?

Answers

Answer:

veto

Explanation:

-
Why had only three settlements been established in Spanish 6 points
Texas by 1820?
A. Few settlers wanted to move there
B. The land was too rugged.
C. The French controlled the area

Answers

Answer:

A. Few settlers wanted to move there

Explanation:

What was a standard process at the beginning of the industrial revolution?
A) Investing in agricultural subsidies
B) Moving companies overseas
C) Selling shares in stocks
D) Hiring young children

Answers

Answer:

It's D) Hiring young children

Explanation:

hope it's correct

Answer:

(D)

Explanation:  

:)

Which of the following statements is included in the Bill of Rights?

Answers

Answer:

the wanted to add the bill of rights

Explanation:

Which of the following events occurred first? a. Texas citizens refused to return a cannon to Mexican authorities. b. General Cós and Mexican forces secured San Antonio and the Alamo. c. Texans defeated the Mexicans at Goliad. d. Texans advanced closer to San Antonio to Concepcion Mission.

Answers

Answer:

A

Explanation:

Answer:

A

Explanation:

I agree with the person on top

List five members of the Constitutional Convention.




Explain the following plans of representation.


*American government*


Virginia Plan




New Jersey Plan






3. Explain the following compromises.


GREAT COMPROMISE




THREE-FIFTHS COMPROMISE




4. Who were the Federalists? What did they want?




5. Who were the anti-federalist? Give two reasons why they opposed the Constitution.

Answers

Answer:

At the Convention, several plans were introduced. James Madison’s plan, known as the Virginia Plan, was the most important plan. The Virginia Plan was a proposal by Virginia delegates for a bicameral legislative branch. Prior to the start of the Convention, the Virginian delegates met and, drawing largely from Madison’s suggestions, drafted a plan. In its proposal, both houses of the legislature would be determined proportionately. The lower house would be elected by the people, and the upper house would be elected by the lower house. The executive branch would exist solely to ensure that the will of the legislature was carried out and, therefore, would be selected by the legislature.

At the Convention, several plans were introduced. James Madison’s plan, known as the Virginia Plan, was the most important plan. The Virginia Plan was a proposal by Virginia delegates for a bicameral legislative branch. Prior to the start of the Convention, the Virginian delegates met and, drawing largely from Madison’s suggestions, drafted a plan. In its proposal, both houses of the legislature would be determined proportionately. The lower house would be elected by the people, and the upper house would be elected by the lower house. The executive branch would exist solely to ensure that the will of the legislature was carried out and, therefore, would be selected by the legislature.image

At the Convention, several plans were introduced. James Madison’s plan, known as the Virginia Plan, was the most important plan. The Virginia Plan was a proposal by Virginia delegates for a bicameral legislative branch. Prior to the start of the Convention, the Virginian delegates met and, drawing largely from Madison’s suggestions, drafted a plan. In its proposal, both houses of the legislature would be determined proportionately. The lower house would be elected by the people, and the upper house would be elected by the lower house. The executive branch would exist solely to ensure that the will of the legislature was carried out and, therefore, would be selected by the legislature.imageVirginia Plan: Visual representation of the structure of James Madison’s Virginia Plan.

At the Convention, several plans were introduced. James Madison’s plan, known as the Virginia Plan, was the most important plan. The Virginia Plan was a proposal by Virginia delegates for a bicameral legislative branch. Prior to the start of the Convention, the Virginian delegates met and, drawing largely from Madison’s suggestions, drafted a plan. In its proposal, both houses of the legislature would be determined proportionately. The lower house would be elected by the people, and the upper house would be elected by the lower house. The executive branch would exist solely to ensure that the will of the legislature was carried out and, therefore, would be selected by the legislature.imageVirginia Plan: Visual representation of the structure of James Madison’s Virginia Plan.After the Virginia Plan was introduced, New Jersey delegate William Paterson asked for an adjournment to contemplate the plan. Under the Articles of Confederation, each state had equal representation in Congress, exercising one vote each. Paterson’s New Jersey Plan was ultimately a rebuttal to the Virginia Plan. Under the New Jersey Plan, the unicameral legislature with one vote per state was inherited from the Articles of Confederation. This position reflected the belief that the states were independent entities and as they entered the United States of America freely and individually, so they remained.

Which of the following was not a problem Sam Houston faced in his second term as president of Texas?
a. religious rebellion
b. extensive debt
c. Mexican invasion
d. land certificate disputes

Answers

Answer:

a.religious rebellion

Answer:

Answer is A

Explanation:

Most probably it will be religious rebellion cuz all the Americans practice christianity

Other Questions
Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies