How do fats and lipids affect the texture of food?

Answers

Answer 1

Answer: Fats and oils can alter a food’s appearance by creating a glossy or moist visual texture. The ability of fat to refract light is also responsible for the opaque appearance of milk. Fats also aid in the browning process of many foods.

:)


Related Questions

Personal hygiene is important to others because __________.
A.
it helps to prevent the spread of disease
B.
you look more pleasing to the eye
C.
everyone should look the same
D.
all of the above



Please select the best answer from the choices provided.


A
B
C
D
Mark this and return

Answers

Answer:

a) it helps to prevent the spread of diseases

the answer to the question is A

What is the main purpose of BMI?

Answers

Answer:

The main purpose of Body Mass Index (BMI) is to estimate an individual's body fat based on their weight and height, as a simple and quick method to assess overall health status. It's widely used as a screening tool to identify individuals who are at risk for certain health problems such as heart disease, diabetes, and certain cancers, associated with being overweight or obese.

Explanation:

The main purpose of Body Mass Index (BMI) is to estimate an individual's body fat based on their weight and height, as a simple and quick method to assess overall health status. It's widely used as a screening tool to identify individuals who are at risk for certain health problems such as heart disease, diabetes, and certain cancers, associated with being overweight or obese.

BMI is calculated by dividing a person's weight in kilograms by their height in meters squared (kg/m²). The resulting number is then used to place an individual into one of four categories: underweight, normal weight, overweight, and obese.

BMI is generally used as a population-level tool, rather than an individual diagnostic tool, to monitor trends and patterns in weight status across populations. It is often used by healthcare providers, researchers and public health professionals to identify the proportion of individuals within a population who are at increased risk of health problems because of their weight.

It's important to note that the BMI alone should not be used as the sole diagnostic tool to assess an individual's health status, as it doesn't take into account other factors such as muscle mass, overall health status and body composition. A more comprehensive approach is needed for an accurate diagnosis of obesity or underweight status and to address overall health status. Factors such as diet, exercise, and overall health markers like blood pressure, cholesterol, glucose and insulin resistance should be taken into account when assessing an individual's health.

A nursing instructor is preparing a class about rural cultures and the influence on mental health problems. Which of the following would the instructor include as impacting the use of mental health services for this group? Select all that apply.

Answers

Nursing instructor must include as impacting the use of mental health services for this group:  Limited access to care, lack of available resources and diverse cultural groups.

How does rural cultures influence mental health?

Rural areas experience severe lack of access to and availability of the full range of health care services, challenges with mental health care workforce recruitment and retention, and also technology barriers impacting telehealth visits.

Culture impacts various aspects of mental health including the perception of health and illness, treatment-seeking behavior and also coping styles. Simplified mainstreaming of mental health approaches may not cater to the needs of culturally diverse population from different communities.

To know more about mental health services, refer

https://brainly.com/question/14102946

#SPJ4

What are 3 types of heat stroke?

Answers

The 3 types of heat strokes are

Heat crampsHeat exhaustionHeat stroke

Heat stroke is the most deadly heat-related illness. It happens when the body's temperature can no longer be controlled: the body's temperature rises fast, perspiration stops, and the body is unable to cool down. Heat stroke causes the body temperature to swiftly rise to 106°F or higher. Heatstroke is a potentially lethal disease induced by excessive body heat.

Heat exhaustion is characterised by profuse sweating and a rapid pulse as a result of your body overheating. It is one of three heat-related diseases, with heat cramps being the mildest and heatstroke being the most serious.

Heat cramps are painful, involuntary muscle spasms that occur after heavy physical activity in hot conditions. The spasms might be more intense and linger longer than regular midnight leg cramps. Heat cramps are typically induced by electrolyte and fluid loss.

To learn more about heat strokes, here

https://brainly.com/question/2107818

#SPJ4

Developing healthy habits is easy for individuals with strong willpower and self-discipline

Answers

Answer:

True!

Explanation:

What are four lifestyle choices?

Answers

Four lifestyle choices that can impact overall health and well-being are diet and nutrition, physical activity, smoking and alcohol consumption, and sleep.

Four lifestyle choices that can impact overall health and well-being include:

Diet and nutrition: What you eat, how much, and how often can affect your overall health and well-being.Physical activity: How active or inactive you are can impact your overall health, including cardiovascular health, muscle and bone strength, and mental health.Smoking and alcohol consumption: These habits can significantly impact overall health and increase the risk of chronic diseases.Sleep: The quality and quantity of sleep you get can affect your overall physical and mental health and well-being.

To learn more about lifestyle habits at

https://brainly.com/question/14699556?referrer=searchResults

#SPJ4

What are some issues that affect your social health?

Answers

Social determinants of health such as poverty, unequal access to health care, lack of education, stigma, and racism are underlying, contributing factors of health inequities.

The vast majority of us are struggling with health issues. The most common health issues include obesity, mood swings, infections, fatigue, and a dull appearance. Healthy living is essential for overcoming all of these obstacles.

Psychologists discuss social health in the context of child development. It is a child's capacity to build solid relationships with people and develop trust so that they may explore and learn in a safe environment. This capacity is intimately related to their ability to regulate their emotions. Adults' social health involves the networks & social support structures that surround them.

According to research, the continuing loneliness & chronic stress of poor social health are connected to a variety of physical health issues. Strong social relationships have been linked to a longer life, less stress, and better heart health, according to research.

To know more about the Social health, here

https://brainly.com/question/17799234

#SPJ4

What are the top 3 lifestyle diseases?

Answers

Answer: (not specific but) heart disease, stroke, diabetes

Explanation:

Using the PHASES OF MOVEMENT , describe how you would describe throwing a frisbee (backhand throw). Explain in the 3 phases- preparation, execution and follow through phases

Answers

Answer:

Preparation phase:

The thrower faces the direction they want to throw the frisbee and takes a few steps back to create space and momentum.

The thrower grips the frisbee with their middle, ring, and pinky fingers on top of the frisbee and their index finger underneath the frisbee.

The thrower lifts the frisbee up to shoulder level with their arm bent and the frisbee resting on their shoulder.

Execution phase:

The thrower pivots their back foot and pushes off with their front foot to generate power and rotation.

The thrower extends their arm and straightens their elbow, using their shoulder and wrist to flick the frisbee forward.

The thrower releases the frisbee with a snap of the wrist, causing the frisbee to spin and fly through the air.

Follow-through phase:

The thrower continues to rotate their body and follow through with their arm after releasing the frisbee, allowing for a smooth and fluid motion.

The thrower adjusts their balance and posture to prepare for the next throw or to move to catch a returned frisbee.

What is the Food Guide Pyramid and who created it?

Answers

Answer:

The Food Guide Pyramid is a guideline created by the US Department of Agriculture to encourage Americans to make healthy choices and to eat a balanced diet.

What does breakfast consist of?

Answers

Answer:

Protein, dairy, wheat and a fruit

Can nightmares have a severe empact on you in any way? like trauma or something?

Explain your reasoning.​

Answers

Answer:

It is possible. If the nightmare scares or shocks you enough you can get trauma.

Answer: Yes nightmares have a sever impact on me.

Explanation:    When I have a nightmare about being chased though the woods, it makes me feel uneasy to being alone anywhere after that. Or when something bad happened like horrible to me done by someone else (nightmare). Then anyone I see, I then make a "stay away vibe" because I scared. Even if its family or friends. I stopped hugging my family cause of some of my nightmares.

Hope this helps any

-would you expect someone with emphysema to have a greater or lesser vital capacity than someone without the disease ? why?

Answers

No, I would not, The vital capacity declines as the degree of emphysema increases.

What is emphysema?

Emphysema is a type of lung disease that causes shortness of breath. The air sacs in the lungs (alveoli) are destroyed in persons with emphysema. The inner walls of the air sacs weaken and rupture over time, resulting in bigger air gaps rather than many small ones.

It is usually assumed that patients with obstructive or bullous pulmonary emphysema have a reduced vital capacity; moderate emphysema is thought to be followed by a minor reduction in vital capacity, and vital capacity declines with increasing severity of emphysema.

Emphysema symptoms and signs take years to develop, but once they do, they typically include shortness of breath, mucous coughing, wheezing, and chest tightness.

Learn more about emphysema here:

https://brainly.com/question/27962002

#SPJ1

Can someone help me with 1 through 10.

Answers

Answer:

1 a mature female reproductive cell, especially of a human or other animal, which can divide to give rise to an embryo usually only after fertilization by a male cell

2 8 to 12 weeks

sorry but thats all i know about it

Explanation:

The experience of vivid geometric images and dreamlike scenes is most likely to be triggered by
a.LSD.
b.heroin.
c.Nembutal.
d.amphetamines

Answers

Answer:

I believe the answer is A - LSD

Which of the following is a characteristic of a coma but is NOT a characteristic of sleep?
a. absence of brain waves ("flat EEG")
b. irreversible brain damage
c. continuously reduced mitochondrial activity in brain neurons
d. All of the listed responses are correct.

Answers

A. absence of a brain waves (“flat EEG”)

Please answer a simple A B or C.
Bianca has recently begun her first job as a pharmacy technician. One morning, she is tasked with filling forty-five different prescriptions while also answering the phone. After working for a few hours, she realizes she probably will not be able to finish filling all the prescriptions while going at her current pace. What is the best way that Bianca could handle her current situation in order to build trust with her coworkers?

A. explain the problem to her boss and ask for suggestions for increasing her productivity

B. have her co-workers take the phone calls while she fills her prescriptions

C. divide the precriptions amongst her co-workers to share the work load

Answers

Answer:

B. have her co-workers take the phone calls while she fills her prescriptions

Explanation:

I took the test.

After being exposed to an organophosphate insecticide, a landscaping worker presents to the emergency department. Decontamination should begin with which step?
A. Brush the insecticide off the patient.
B. Remove the patient's clothing.
C. Place the patient is a well-ventilated, isolated area.
D. Apply a neutralizing agent.

Answers

After being exposed to organophosphate insecticide, landscaping worker presents to the emergency department. Decontamination should begin with : C. Place the patient in a well-ventilated, isolated area.

What should be done after being exposed to organophosphate insecticide?

For the safety of other patients and staff members, place the patient in a well-ventilated and isolated area for decontamination. After donning personal protective equipment,  gloves and goggles, carefully remove  patient's clothing. Then brush off the insecticide, if it was of a dry type.

Decontaminate patient with copious amount of water. Do not apply any neutralizing agent because it may cause exothermic reaction that produces heat.

To know more about organophosphate insecticide, refer

https://brainly.com/question/28547821

#SPJ4

How do you write an action plan example?

Answers

Action plans occasionally serve as a communication tool that exemplifies a radical simplification of intricate initiatives and programmes. A city may, for instance, utilise an action plan to express goals for a neighbourhood improvement project that include adding more green space, amenities, living streets, and better rail service.

What is a straightforward action plan?

Action plans are simply lists of all the things you have to do to accomplish a goal. They differ from to-do lists in that they concentrate on the accomplishment of just one objective. Action plans are helpful since they provide a foundation for conceiving about how you'll successfully execute a project.

A five-step approach is required to create such a strategic plan: Identify a broad vision. Make a statement of intent.

Learn more about Action plans refer

https://brainly.com/question/1647350

#SPJ4

What is an action plan with example?

Answers

Action planning is the planning that guides your day-to-day work. Without a strategic framework you don’t know where you are going or why you are going there.

And then, it doesn’t really matter how you get there. But without an action plan, it is likely that the strategic plan will remain a grand dream and you won’t get there anyway. This toolkit aims to help you do detailed, useful action planning, and takes the user through a process that could be replicated in an organisation or project.

When you need to plan operationally, on the basis of a strategic planning process, and to make a distinction between strategic planning and operational or action planning. When you need some ideas to help you develop an action planning process.

When you are ready to move a new organisation or project from the strategic planning phase to the operational phase.When you feel you need to review your operational plans because, for example, your strategy has changed.

To know more about action planning here

https://brainly.com/question/17497765

#SPJ4

The best way to ensure adequate absorption of dietary iron when consuming soy products is to:
a. consume three times the amount of iron recommended for meat eaters.
b. include caffeinated beverages with the meal.
c. increase your saturated fat intake.
d. include vitamin C-rich foods because they enhance absorption of iron.

Answers

The best way to ensure adequate absorption of dietary iron when consuming soy products is to: include vitamin C-rich foods because they enhance absorption of iron.

It has been shown that vitamin C can boost the amount of non-heme iron that the body receives from plant sources. Citrus fruits, tomatoes, potatoes, strawberries, green and red bell peppers, broccoli, Brussels sprouts, and kiwis are all high in vitamin C.

Other than animal tissue, vitamin C is the only dietary element that has been demonstrated to enhance iron absorption. Iron is mostly absorbed in the duodenum and upper jejunum, where ferrous iron can be transferred into small intestine mucosal epithelial cells.

Iron deficiency is frequent in women, children, and vegetarians, thus increasing iron levels with vitamin C supplementation is a smart way to ensure that these groups maintain appropriate iron levels.

For more information on vitamin C , visit :

https://brainly.com/question/29350266

#SPJ4

How would you encourage others to perform physical activities and influence them to become active and live a healthy life?

Answers

After supper, go for a stroll or play a game of tag as a family. Bowling, catch, or miniature golf are examples of activities that involve mobility. Choose your toys wisely. Toys that stimulate physical activity, such as balls, kites, skateboards, and jump ropes, should be given to youngsters.

What strategies will you use to motivate other students to lead active lifestyles?

Encourage and motivate all school-age youngsters by remaining upbeat and happy at all times. By taking care of your health and engaging in exercise, you may serve as an example for kids at school. Establish a setting where school-age children feel comfortable taking chances and trying out new things.

Learn  more about physical activities to visit this link

https://brainly.com/question/14338730

#SPJ4

What is the importance of participating in physical activities in your daily life?

Answers

Answer: Being physically active can improve your brain health help manage weight reduce the risk of disease strengthen bones and muscles, and improve your ability to do everyday activities.

Explanation:

What are 4 examples of choices that promote good health?

Answers

Healthy eating is one of these  behaviours.

being active on a regular basis.

quitting smoking

the maintenance of a healthy weight.

Why is excellent health important?

Good health is a result of regular exercise, a balanced diet, and enough sleep. When it is required, individuals undergo medical care to keep the balance. Maintaining a healthy lifestyle to lower the risk of illness is a key component of physical well-being.

A number of organs work together to operate as a body.  Having excellent health is crucial since it refers to a condition of complete physical, mental, and social wellbeing.

learn more about good health refer

https://brainly.com/question/16330735

#SPJ4

What were the 3 natural rights according to Locke?

Answers

Among the fundamental natural rights, Locke said, "life, liberty, and property" were the 3 natural rights. Locke also believed that basic human law of nature is the preservation of mankind.

What were 3 natural rights according to Locke?

The three natural rights according to Locke are life, liberty and property. Two common natural rights are rights to life and liberty. John Locke famously advocated for the right to property, whereas Thomas Jefferson advocated for the right to the pursuit of happiness.

Locke pioneered the ideas of natural law, social contract, religious toleration, and also the right to revolution that proved essential to the American Revolution and the U.S. Constitution that followed.

To know more about Locke, refer

https://brainly.com/question/870852

#SPJ4

What are the benefits of recreational activities that affect ourselves physically mentally and spiritually?

Answers

Recreational activities provide many physical, mental and spiritual benefits. Physically, participating in recreational activities enhances physical health by increasing our strength, flexibility and endurance.

It also helps us to maintain a healthy weight, lower the risk of chronic diseases and reduce stress. Mentally, recreational activities can increase our cognitive abilities, help us to better manage stress, and develop better problem solving skills. It can also help to improve mood, lower anxiety, reduce depression and improve self-esteem.

Spiritually, recreational activities can help us to develop a greater sense of purpose, encourage us to live in the present moment, and give us the opportunity to express our creativity, connection and spirituality. All of these benefits are important in helping us to live a healthy and balanced life.

To learn more about Recreational activities visit:

https://brainly.com/question/6154

#SPJ4

What are the 4 requirements for bacterial growth?

Answers

The four basic requirements for bacterial growth are: moisture, food, warmth, and time.

Bacteria need moisture to survive, so they can grow in damp environments like food, water, or soil. They also require a food source, which can include carbohydrates, proteins, and fats. Bacteria also need warmth to grow, which is why they grow more rapidly at temperatures between 40°F and 140°F (4.4°C and 60°C), also known as the "Danger Zone". Finally, bacteria need time to grow and multiply, which is why they can quickly colonize and spoil food that is left out at room temperature for too long.

It's important to note that not all bacteria are harmful, but many can cause food poisoning or other health problems. Therefore, it's important to understand the basic requirements for bacterial growth in order to take steps to prevent it. This includes proper food handling and storage, maintaining appropriate temperatures, and practicing good hygiene. Additionally, avoiding cross-contamination and using clean and sanitized equipment, utensils, and surfaces can help to prevent bacterial growth. Proper cooking and reheating of food can also help to kill harmful bacteria and prevent food poisoning.

To know more about bacterial growth click below:

brainly.com/question/14461247#

#SPJ4

What lifestyle choices positively affect physical fitness?

Answers

Regular physical exercise, a well-balanced diet, and adequate sleep are all lifestyle choices that have a good impact on physical fitness.

Physical fitness entails the functioning of the lungs and heart as well as the body's muscles. And, because what we do with the bodies affects what we can accomplish with the minds, fitness influences attributes like mental attentiveness and emotional stability to some extent.

The way you live has a big impact on your health, wellness, and fitness. Today's metropolitan lifestyle, in which people do not pause and take some time for themselves, is doing more harm than good to their physical and mental health. Obesity has been linked to a lack of healthy food alternatives in many people of all ages today.

Every day, aim for at least 30 minutes of physical activity. Consider everyday tasks to be a chance to be active. Make time for frequent, intense exercise for further health and fitness advantages.

To know more about the Physical fitness, here

https://brainly.com/question/14338730

#SPJ4

What is the definition of behavior in fitness?

Answers

Behavior in fitness refers to actions or habits related to physical activity, exercise, and overall well-being.

These behaviors include things like regular exercise, healthy eating, maintaining a balanced lifestyle, and making positive choices that support overall health and fitness goals. These behaviors can be influenced by a variety of factors such as personal motivation, social support, and environmental factors. It's important to note that the behaviors are not only restricted to physical activity but also mental health, and overall well-being. Changing or adopting healthy behaviors can lead to positive outcomes such as improved cardiovascular health, better weight management, stronger bones and muscles, and reduced risk of chronic diseases. These behaviors can have a significant impact on an individual's overall physical and mental health. Therefore, having a good understanding of fitness behavior is important for promoting health and fitness among individuals.

To know more about  fitness click below:

https://brainly.com/question/8860814#

#SPJ4

Can a hormone turn a gene on or off?

Answers

Yes, a hormone can turn a gene on or off.

Hormones are molecules that act as chemical messengers that travel through the body and bind to specific receptor sites on the surface of cells. When it binds to the receptor site, it triggers a gene to either be turned on or off. This can alter gene expression and ultimately affect the structure and function of the cell.

For example, hormones like estrogen, testosterone, and insulin can bind to receptor sites and activate specific genes. This can result in changes in the cell such as cell differentiation, growth, and metabolism. Ultimately, hormones can have a powerful effect on gene expression and significantly impact the health and development of an organism.

To know more about Hormone:

brainly.com/question/26958360

#SPJ4

Other Questions
f(n) = 2n-1 find the arithmetic sequence ? Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day.