Going about her cleaning routine as usual, Jayla sprays an aerosol bleach cleanser in her bathroom and then leaves to let it air out before she scrubs it down. Only two or three minutes later, she notices her cat, Grimaldi, fleeing the bathroom, coughing. Jayla hadn’t realized that Grimaldi was in the bathroom when she sprayed the chemical, so she rushes over to check on him. He seems to be wheezing and shaking a bit. Calling the vet, he asks Jayla to explain how Grimaldi was exposed to the chemical. Hearing Jayla’s explanation, which method of poisoning will the vet MOST likely assume Grimaldi is dealing with?

ingested poison

absorbed poison

injected poison

inhaled poison

Answers

Answer 1

Answer:

inhaled poison

Explanation:

Grimaldi was inside the bathroom when Jayla sprayed the aerosol bleach cleanser. The molecules of this cleanser spread quickly through the surroundings. Since the cat was inside the bathroom, it could have inhaled the bleach and the poison reached its lungs. This caused symptoms of wheezing, which is respiratory in nature, and shaking (seizures). Inhaling a poison leads to difficult in breathing among animals because it can cause the lungs to be inflamed.

Answer 2
Inhaled. This one was easy!

Related Questions

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Answers

the fourth one is correct
The answer is D!!!!!!!!

What is the healthy percentage of body fat for men?

Answers

Answer:

The answer would be 18-24%.

Explanation:

The amount of essential fat differs between men and women, and is typically around 2-5% in men, and 10-13% in women. The healthy range of body fat for men is typically defined as 8-19%, while the healthy range for women is 21-33%.

why are technical schools established?​

Answers

It established vocational education as acceptable training for certain future professionals who wouldn't need bachelor's degrees to do their jobs, such as plumbers, mechanics, and factory workers. They completed their training in focused vocational programs associated with high schools.

The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.

Answers

first one fits best!

Answer:

It is A!!!!

Explanation:

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

Answers

An eye on each side of the sagittal plate
2./ B. an eye on each side of the sagittarius plane

how do I make a homemade bandaid ​

Answers

Answer:

Put a paper Towel down and tape it

Explanation:

Don’t be a real man, that is my answer

MEDICAL TERMINOLOGY!!

Answers

Medical terminology is language used to precisely describe the human body including its components, processes, conditions affecting it, and procedures performed upon it. Medical terminology is used in the field of medicine.

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

Answers

Answer:b

Explanation:

Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

What is heart?

Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.

The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.

Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

To learn more about heart, refer to the link below:

https://brainly.com/question/16566688

#SPJ2

16. The use of an electronic signature needs to be in compliance with
ОНІРАА.
O AMA.
Ostate laws.
O HEDIS.

Answers

Maybe state laws since your signature is on your identification? Not sure.

Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.

For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.

After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.

Answers

Answer:

Focus on the issue, not the person. ...

Be genuine rather than manipulative. ...

Empathize rather than remain detached. ...

Be flexible towards others. ...

Value yourself and your own experiences. ...

Use affirming responses.

Meet regularly. Hold regular strategy meetings for the entire team. ...

Be inclusive. ...

Be transparent, clear and concise. ...

Show some respect. ...

Recognize that being right may be wrong. ...

Use online collaboration tools.

Explanation:

''.''

What is the function of the serous membrane? (Be specific about what types of body cavities)

Answers

To transfer semen from the uterus to the finger nails

Answer:

Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.

Explanation:

BRAINLIEST PLZZZZZZ

How do blood types react in a transfusión ?

Answers

Answer:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Explanation:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Solve: -3x+1<-5
X>
X> 2
4
x<-2

Answers

The answer is X>2 :))

HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting

Answers

i believe the answer is D. it seems like the most reasonable one

The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.

Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.

What is evidence of the pattern?

Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.

Thus it clearly concludes that photography with direct lighting can collect great evidence.

To know more about tire track evidence refer to the link :

https://brainly.com/question/13397634

Complete the sentence to describe a procedure for food animals. Bulls are to improve the quality of beef, and to make the animals easier to manage.

Answers

Answer:

Castrated

Explanation:

Castration of bulls: Bulls or male calves are castrated to improve the quality of beef. This procedure also makes the animals less aggressive towards the rest of the herd.

Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as

1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.

PLEASE HURRY

Answers

number two! good luck!

Answer:

Explanation:

the second part is cardiac arrest

Other Questions
How many cubes with side lengths of cm does it take to fill the prism?41 cmPro7cm42 cm What is the probability that a customer ordered a cold drink given that he or she ordered a large? 4) Which of the following is NOT true about lysozyme:A) it destroys bacteriaB) it cleanses and protects the eyeC) it is an enzymeD) it is found in tearsE) it stimulates the rods and cones 1.The entry tickets at a community fair cost $5 for children and $10 for adults. On a certain day 1000 people entered in the fair and \$7,100is collected. How many adults and how many children were at the fair? The constant term in the expression 3x2 + 5x 4 is ? . A group of 80 students was asked to share how they get to school most of the time. The following circle graph represents their answers to the question. How many of the students walk to school most days?0242025 What is the quotient of -3/8 and -1/3 Beth is making fruit salad. She adds 4 grapes for every 2 strawberries. If she uses 20 strawberries, how many grapes will she use? Please help .....................................................first question:Which mathematical property is demonstrated?574=547associative property of additioncommutative property of additioncommutative property of multiplicationassociative property of multiplication...................................................................................2nd question:Which expressions are equivalent to 4(7y)?(choose all correct answers)1. (7y)42. 47+4y3. (47)y4. 28y5. 474y....................................................Last questionis 3(ab) and 3a3b Equivalent? yes/nois 2a(2+b) and 4ab Equivalent? Yes/noTHANK YOU!!! What is the y-intercept? this makes no sense to me lol Suppose that two objects attract each other with a gravitational force of 16 units. If the mass of both objects was tripled, and if the distance between the objects was doubled, then what would be the new force of attraction between the two objects? What is the total surface area of this cylinder? (WILL GIVE BRAINLIEST) Help needed ASAP. how do you work8x= -4x -3x An earthquake happened in a area almost everyone in the area feels the earthquake, but no buildings are damaged what is the intensity of the earthquake in the area? ___ presided over the Burr trial.Chief Justice John MarshallLieutenant Stephen DecaturCaptain Meriwether LewisSecretary of State James MadisonPresident Thomas Jefferson Probability.It has been estimated that about 30% of frozen chickens contain enough salmonella bacteria to cause illness if improperly cooked. A consumer purchases 12 frozen chickens. What is the probability that the consumer will have more than 6 contaminated chickens. what does it mean to live in Exponential Times? please help thank you Convert 6 4/5 to an improper fraction.Convert 5 3/4 to an improper fraction.Solve: 3 1/3 25/4Solve: 14/3 3 1/2Solve 3 1/4 5 1/2