During a field trip, an instructor touched a moth resting on a tree trunk. The moth raised its forewings to reveal large eyespots on its hind wings. The instructor asked why the moth lifted its wings. One student answered that sensory receptors had fired and triggered a neuronal reflex culminating in the contraction of certain muscles. A second student responded that the behavior might frighten predators. Which statement best describes these explanations?

Answers

Answer 1

Answer:

The first explanation refers to proximate causation, whereas the second refers to ultimate causation.

Explanation:

Answer 2

The first example refers to proximate causation, whereas the second example to ultimate causation.

What is ultimate causation?

The ability of one variable to impact another is known as causality, also known as causality. The first variable might create the second or might change the incidence of the second variable.

Correlation, which shows how much two variables tend to rise or fall together, and causation are frequently misconstrued. Correlation does not, however, automatically imply causality. The variations in both variables could be caused by a third component, for instance.

A statistically significant association has been shown between yellow cars and a reduced accident frequency. Just because there are fewer accidents involving yellow cars does not mean that they are any safer. A third element, such as the person's personality type.

Therefore, The first example refers to proximate causation, whereas the second example to ultimate causation.

To learn more about causation, refer to the link:

https://brainly.com/question/10971583

#SPJ5


Related Questions

Mom has O blood and dad has O blood. What blood type(s) will their children have?

Answers

Answer:

A mother who is blood type O can only pass an O allele to her son or daughter. A father who is blood type AB could pass either an A or a B allele to his son or daughter.

Explanation:

Hope this helped :)

2 Lin sulks during the first week of rehearsals because she is – A tired from working on the set B bored with her duties as a designer C confused about the directions given to her D disappointed with the assignment she received​

Answers

Answer:

skull tropper

Explanation:

I got it from the guy from fortnite

what story is that from

!PLEASE ANSWER ASAP! How much of farmed aquaculture in the US consists of oysters?

Answers

two thirds

Explanation:

a 30 rock cut cave monuments famous for its murals



Ineeditnow​

Answers

Answer:

Ajanta Caves

Explanation:

The Gulf of Mexico dead zone is an area of hypoxic waters at the mouth of the Mississippi River. Its area varies in size, but can cover up to 6,000-7,000 square miles. The zone occurs between the inner and mid-continental shelf in the northern Gulf of Mexico, beginning at the Mississippi River delta and extending westward to the upper Texas coast. Thousands of farms are located along the Mississippi River and its tributaries and as water washes into the river after a heavy rain, it brings with it nutrients from fertilizers added to farmland. These materials flow downriver and eventually enter the Gulf of Mexico, where they create conditions for a dead zone: an area of low to no oxygen that results in the death of fish and other marine life. The Gulf of Mexico is a major source area for the seafood industry. The Gulf supplies 72% of U.S. harvested shrimp, 66% of harvested oysters, and 16% of commercial fish. Consequently, if the hypoxic zone continues or worsens, fishermen and coastal state economies will be greatly impacted. What can be done to minimize the Gulf dead zone? Choose ALL that could apply. A) Control of animal wastes so that they are not allowed to enter into waterways. B) Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland. C) Monitor septic systems and sewage treatment facilities to reduce discharge of nutrients to surface water and groundwater. D) Restrict land use in the areas surrounding the Mississippi delta to exclude industrial sites. E) Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

Answers

This Is Confusing Could U put more Details

The things that should be done to minimize the Gulf dead zone include:

A. Control of animal wastes so that they are not allowed to enter into waterways. B. Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland.E. Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

It should be noted that it's important to manage nutrients efficiently in farmlands through the restoration of wetlands in order to capture nutrients and then reduce runoff.

In order to minimize the Gulf dead zone, there should be control of animal wastes so that they are not allowed to enter into waterways. Also, there should be an adjustment of the timing of fertilizer applications to limit runoff of excess nutrients from farmland.

Read related link on:

https://brainly.com/question/17876202

What is a negative feedback loop? Provide an example NOT related to Biology. (I will give brainliest)

Answers

Answer:

Examples of processes that utilise negative feedback loops include homeostatic systems, such as Thermoregulation if body temperature changes, mechanisms are induced to restore normal levels) Blood sugar regulation (insulin lowers blood glucose when levels are high glucagon raises blood glucose when levels are low)

Explanation:

Answer: A negative feedback loop is basically a procedure that uses criticism to make positive changes to a process

Can throat cancer be inherited?

Answers

Most throat cancers are generally related to smoking and not hereditary, unless the family members are predisposed to smoking.

No not really. Only genes

A false-positive csf serologic test for neurosyphilis in a treated patient can occur if:

Answers

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs). The cerebrospinal fluid (CSF) serologic test is a significant diagnostic tool used in the diagnosis of neurosyphilis. However, it has been observed that this test can produce false-positive results, even in treated patients. This can occur due to various reasons, including contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).Contamination: This is one of the most common reasons for false-positive results in CSF serologic tests. This can occur due to errors during the collection, transport, and processing of the specimen. Even minor contamination can lead to false-positive results in these tests. Therefore, it is essential to ensure that the sample is appropriately collected, handled, and processed.Serologic cross-reactivity: Another reason for false-positive results in CSF serologic tests is serologic cross-reactivity. This occurs when the antibody produced in response to an infection or vaccination reacts with the antigen of another microorganism. In the case of neurosyphilis, cross-reactivity can occur with other spirochetes such as Borrelia burgdorferi, which causes Lyme disease.The persistence of nontreponemal antibodies: The nontreponemal antibodies produced in response to syphilis can persist even after the treatment. These antibodies can lead to false-positive results in the CSF serologic test, even though the patient has been adequately treated. Therefore, the presence of nontreponemal antibodies should be taken into account while interpreting the test results.A rebound phenomenon: The rebound phenomenon is another reason for false-positive results in CSF serologic tests. This phenomenon occurs when there is a rapid decrease in the antibody titer after the treatment, followed by a rapid increase. This can lead to false-positive results, even if the patient has been adequately treated.Biological false positives (BFPs): BFPs are a rare phenomenon that can lead to false-positive results in CSF serologic tests. This can occur due to a genetic mutation or immunological condition that leads to the production of an antibody that reacts with the antigen in the serologic test.

To know more about cerebrospinal fluid visit: https://brainly.com/question/13050022

#SPJ11

_____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) View Available Hint(s) _____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) A decrease ... a drop An increase ... a rise An increase ... a drop A decrease ... a rise Actually, it is the rise and fall of oxygen, not carbon dioxide, that controls breathing.

Answers

Answer:

1 An increase

2 A drop

Explanation:

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

T/F. short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window.

Answers

The statement "short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window" is true.

To provide a more accurate explanation:

The cochlea, a spiral-shaped structure in the inner ear, plays a crucial role in the process of hearing. Within the cochlea, the basilar membrane is a key component that vibrates in response to sound waves.

When sound waves enter the ear, they travel through the auditory system and reach the cochlea. The oval window, which is located at the base of the cochlea, receives these sound vibrations and sets the fluid inside the cochlea into motion. This motion causes the basilar membrane to vibrate.

The basilar membrane is structured in a way that it varies in width and stiffness along its length. This variation allows different regions of the basilar membrane to respond selectively to different frequencies of sound. The base of the cochlea, near the oval window, is narrower and stiffer, while the apex of the cochlea is wider and more flexible.

High-pitched sounds, which have short wavelengths and higher frequencies, specifically cause displacement of the basilar membrane near the base of the cochlea, close to the oval window. This region of the basilar membrane is more responsive to high-frequency sounds. As a result, the basilar membrane near the oval window detects and responds to these short-wavelength, high-pitched sounds.

In summary, short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window, as this region is specifically responsive to high-frequency sounds.

To know more about wavelengths follow the link:

https://brainly.com/question/31143857

#SPJ4

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

nad is directly involved a) only glycolysis b) only ppp c) both pathways d) neither pathway

Answers

NAD (Nicotinamide adenine dinucleotide) is directly involved in (C) both glycolysis and the pentose phosphate pathway (PPP).

In glycolysis, NAD acts as a coenzyme and plays a crucial role in the redox reactions of the pathway. During the conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, [tex]NAD^{+}[/tex] is reduced to NADH. This reduction reaction allows NADH to carry high-energy electrons to the electron transport chain for ATP production.

In the pentose phosphate pathway, [tex]NADP^{+}[/tex] (a phosphorylated form of NAD) serves as a coenzyme. [tex]NADP^{+}[/tex]is utilized in the oxidative phase of the pathway to facilitate the oxidation of glucose-6-phosphate to generate NADPH. NADPH is an important reducing agent used in biosynthetic processes, antioxidant defense, and reductive reactions within the cell.

Therefore, NAD is directly involved in both glycolysis (in the form of NADH) and the pentose phosphate pathway (in the form of [tex]NADP^{+}[/tex] and NADPH). The correct answer is option C) both pathways.

Learn more about NAD (Nicotinamide adenine dinucleotide):

https://brainly.com/question/30323008

#SPJ11

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

Ferns tend to live in which of the following habitats?"
moist and sunny
moist and shady
O dry and sunny
Odry and shady

Answers

Answer:

Moist and shaddy

Explanation:

moist and shady
hope it helps

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

Which of the following is the correct binomial format? O Genus species O Phylum class O Species O Order family

Answers

The correct option is A, The correct binomial format is "Genus species."

Genus species is a scientific naming convention used in taxonomy to classify and categorize living organisms. It represents the two main levels of classification below the higher taxonomic ranks of family, order, class, phylum, and kingdom. The genus refers to a group of closely related species that share common characteristics and ancestry. It is always capitalized and italicized when written in scientific literature.

The species name, on the other hand, is a specific epithet that further distinguishes individual organisms within a genus. It is written in lowercase and also italicized. The combination of the genus and species names provides a unique binomial nomenclature for each organism, enabling scientists to communicate and identify species consistently. For example, Homo sapiens represents the genus Homo (including humans and their close relatives) and the species sapiens, which is specific to modern humans.

To learn more about Genus species visit here

brainly.com/question/30346312

#SPJ4

PLZ HELP 25 POINTS!!!

Give an example of how Eubacteria can be harmful. Explain.

Answers

Answer: However, bacteria can also cause disease. Examples of bacterial diseases include tetanus, syphilis, and food poisoning. Bacteria may spread directly from one person to another. For example, they can spread through touching, coughing, or sneezing. Some Eubacteria can induce serious diseases such as tuberculosis, meningitis, anthrax, leprosy, cholera and tetanus. Antibiotics disrupt normal functioning of bacterial ribosomes or synthesis of the cell wall and prevent further multiplication of bacteria in the body.

Explanation:

Chloroplasts do photosynthesis in which plant structure?
A. stem

B. leaves

C. roots

Answers

The answer will be b

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

According to catastrophists what was the rate of geological change?

Answers

Catastrophism is the theory that the Earth has largely been shaped by sudden, short-lived, violent events, possibly worldwide in scope.[1] This is in contrast to uniformitarianism (sometimes described as gradualism), in which slow incremental changes, such as erosion, created all the Earth's geological features. The proponents of uniformitarianism held that the present was the key to the past, and that all geological processes (such as erosion) throughout the past were like those that can be observed now. Since the early disputes, a more inclusive and integrated view of geologic events has developed, in which the scientific consensus accepts that there were some catastrophic events in the geologic past, but these were explicable as extreme examples of natural processes which can occur.

do you agreed that cell is a building unit of organism yes explain why?class 9​

Answers

Answer:

It can be, but not really

Explanation:

This is because cells can be the building block of an organism, e.g. humans, but they can also be their own separate organism, such as a bacteria.

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

The diagram shows part of an aquatic food web
for a stable lake ecosystem in Connecticut.
Turtles
Large fish
Small fish
Aquatic insects
Tadpoles
Water fleas
Rotifers
Algae
What is the source of energy for the algae?
A waves
B. sunlight
C. bacteria
D. rotifers, water fleas and tadpoles

Answers

Answer:

Sunlight

Explanation:

I just got it wrong because of the wacko below or above me gave me the wrong answer

Algae possess chlorophyll in their cells. They use carbon dioxide in a manner that is analogous to how we use food. Thus, option B is correct.

What is a characteristic feature of algae?

By converting light energy to chemical energy through the process of photosynthesis, carbon dioxide and water are transformed into organic molecules.

Nearly all algae engage in the process, and in fact, much of what is currently known about photosynthesis was first uncovered through research on the green alga Chlorella.

Like other plants, algae benefit from sunlight, therefore denying them of it will limit or even completely stop their growth. For several days, completely shading the tank or aquarium from light is essential.

Therefore,  algae require sunshine because algae can photosynthesize, or use sunlight to change carbon dioxide into biological material.

Learn more about algae here:

https://brainly.com/question/13921782

#SPJ2

Other Questions
The Polishing Department of Major Company has the following production and manufacturing cost data for September. Materials are entered at the beginning of the process. Production: Beginning inventory 1,500 units that are 100% complete as to materials and 30% complete as to conversion costs; units started during the period are 40,000; ending inventory of 5,000 units 10% complete as to conversion costs. Manufacturing costs: Beginning inventory costs, comprised of $20,100 of materials and $11,110 of conversion costs; materials costs added in Polishing during the month $166,650; labor and overhead applied in Polishing during the month, $125,700 and $257.240, respectively. Compute the equivalent units of production for materials and conversion costs for the month of September. Materials Conversion Costs The equivalent units of production e Textbook and Media Compute the unit costs for materials and conversion costs for the month. (Round unit costs to 2 decimal places, e.g. 2.25.) Materials Conversion Costs Unit costs $ eTextbook and Media Determine the costs to be assigned to the units transferred out and in process. (Round unit costs to 2 decimal places, e.g. 2.25 and final answers to 0 decimal places, e.g. 1,225.) Transferred out Ending work in process $ e Textbook and Media A pizza place has only the following toppings: ham, mushrooms, pepperoni, anchovies, bacon, onions, chives and sausage. What is the total number of available pizzas? Consider the binary operation a*b = ab on Q\{0}. Show that * is associative and commutative. What is the identity element for *? Under what circumstances are property taxes ?and certain other expenses owed at death deductible on Form 706 or Form 1041 subtract 2 2 4 1 2x 2 4x1minus, 2, x, squared, plus, 4, x, minus, 1 from 6 2 3 9 6x 2 3x96, x, squared, plus, 3, x, minus, 9. eukaryotic mitochondria harvest energy from the breakdown of organic molecules in cellular respiration to generate atp. how do bacteria generate atp using the same series of reactions?group of answer choicesbacteria only generate atp using substrate level phosphorylation and therefore do not need a proton gradientbacteria carry out the reactions in specialized granulesthe biochemical reactions occur in the cytoplasm with the proton gradient for atp production occurring across the cell membranebacteria carry out the reactions in the cell wallthe biochemical reactions occur in the periplasmic space with the proton gradient for atp production occurring across the cell membrane A total of 100 undergraduates were recruited to participate in a study on the effects of study location on learning. The study employed a 2 x 2 between-subjects design, with all participants studying a chapter on the science of gravity and then being tested on the to-be-learned material one week later. Fifty of the participants were asked to study the chapter at the library, whereas the other fifty were asked to study the chapter at home. As a separate manipulation, participants were either told to study the chapter for 30 min or 120 min. The hypothetical set of data shown below represents the level of performance of participants on the test as a function of condition. 30 min 120 min Library 60 80 Home 40 60a) Is there a main effect of Study Location? In answering, provide the marginal means and state the direction of the effect (if there is one).b) Is there a main effect of Study Duration? In answering, provide the marginal means and state the direction of the effect (if there is one).c) Do the results indicate an interaction? If so, describe the nature of the interaction by comparing the simple effects.d) Illustrate the results with a bar graph (make sure the variables and axes are labeled appropriately)e) Interpret the results. What do they tell you about how study location affects learning? (be sure to refer to the interaction or lack thereof) 5. In relation to question 4, An opinion has been given by one of the managers to negotiate with the bank to defer the first loan payment until the end of year 4 and it would be paid in 7 equal installments at 5% interest. If the bank wishes to earn the same profit, what should be the annual payment? solve the problem showing cash flow, and final answer using a suitable formula. ( 10 POINTS) 1An insurance company wants to know if the average speed at which men drive cars is higher than that of women drivers. The company took a random sample of 27 cars driven by men on a highway and found the mean speed to be 72 miles per hour with a standard deviation of 2.2 miles per hour. Another sample of 18 cars driven by women on the same highway gave a mean speed of 68 miles per hour with a standard deviation of 2.5 miles per hour. Assume that the speeds at which all men and all women drive cars on this highway are both approximately normally distributed with unknown and unequal population standard deviations.a. Construct a 98% confidence interval for the difference between the mean speeds of cars driven by all men and all women on this highway.b. Test at a 1% significance level whether the mean speed of cars driven by all men drivers on this highway is higher than that of cars driven by all women drivers.c. Suppose that the sample standard deviations were 1.9 and 3.4 miles per hour, respectively. Redo parts a and b. Discuss any changes in the results A stock had returns of 16.27 percent, -6.23 percent, and 23.48 percent for the past three years. What is the standard deviation of the returns? Multiple Choice 24.02% 15.50% 8.95% 2.40% 12.22% he management of Game-Inn Hotel, despite being a huge facility, had relied mostly on ystems for its operations. The management of the facility recently decided to re-brand using technology strongly in STATISTICS16. Assume that a sample is used to estimate a population mean, . Use the given confidence level and sample data to find the margin of error. Assume that the sample is a simple random sample and the population has a normal distribution. Round your answer to one more decimal place than the sample standard deviation. 99% confidence, n = 21, mean = 108.5, s = 15.3A. 3.34B. 99.00C. 9.50D. 2.85 Find the interest rate (with annual compounding) that makes the statement true. Round to the nearest tenth when necessary. $370 grows to $455.47 in 10 years None of these. 5.75% 3.5% 5.95% Perform a SWOT analysis of your firm. Your analysis should alsotie the internal strengths to the environmental opportunities, i.e.what strengths best match the external opportunities. TRUE OR FALSE adults need at least 1 hour and 30 minutes of vigorous-intensity aerobic activity per week for important health benefits. please select the best answer from the choices provided. t f Consider the following IS-LM model: C= 200+.65YD, I = 150+ .25Y - 1000i, G = 250, T = 200, Md>P=2Y-8000i, M/P = 1600 a. Derive the IS relation and LM relation Kindly solve the questions below with introductionQ1a) Using any service sector of your choice, develop a strategic service vision. In your service vision report, indicate how you intend to capture and sustain your service niche and justify your preferred competitive service strategy.Q1b) Evaluate the service location considerations and discuss how you will balance a marketspace and marketplace to ensure efficient service delivery in the service encounter triad. Question 6 Determine the extreme point (x*, y*) and its nature of the following function: z = 3x - xy + y + 5x + 3y + 18 23 (-13, -2), Minimum 19 49 4), Maximum 19 19 (-1,-), Maximum (-10-13839) Which one of the following statements is correct?A :All of the major stock exchanges are U.S. based.B :The NYSE was created by the National Association of Securities Dealers in the early 1970s.C :The American Stock Exchange is a dealer market.D :OTC markets have a physical trading floor generally located in either New York City or Chicago.E :The primary purpose of the NYSE is to match buyers with sellers. Conjugate the verbs in the correct form of the preterite or imperfect to complete the paragraph. Ayer enter answer (haber) un accidente en la calle Serrano. Cuando sali de mi casa no enter answer (saber) del accidente. Llegu a la interseccin y vi que nadie enter answer (poder) atravesar. No enter answer (querer) llegar tarde para mi primera clase porque tenamos un examen. Yo enter answer (tener) que 3:57 9/9/ Serrano. Cuando sali de mi casa no enter answer (saber) del accidente. Llegu a la interseccin y vi que nadie enter answer (poder) atravesar. No enter answer (querer) llegar tarde para mi primera clase porque tenamos un examen. Yo enter answer (tener) que buscar otra ruta y al final enter answer (poder) llegar a tiempo.