Explanation:
Given
mass of coolie = 40 kg
Mass of salt = 20 kg
Total mass (m) = 40 + 20 = 60 kg
Displacement (h) = 20*20 = 400 CM = 4 m
Work done (w) = ?
Power (P) = ?
We know we have the formula
work done =force × displacement
or work done = m * g * h
work done = 60×10×4
work done = 2400 joules
Similarly
power = work/time
power = MGH/time
power=60×10×4/120
power=2400/120
power= 20watt
Hope it will help you :)❤
If a male organism has 40 chromosomes in each body cell, how many chromosomes does a female of the same sex have in each of her body cells?
Answer:
40
Explanation:
they're usually the same
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
please answer this for me
Answer:
Im pretty sure its A the phagocytes.
Explanation:
2. Name 2 parasitic flatworms.
Explanation:
Both flukes and tapeworms are parasites with vertebrate hosts, including human hosts. Flukes live in the host's circulatory system or liver. Tapeworms live in the host's digestive system.
Answer:
any two flatworms are
1. tapeworm
2. liverworm
Explanation:
hopes it could help you
all you need is in the photo
Answer:
Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.
Explanation:
hope this helps if not i'll try to figure out the answer for you
Can someone help me with the question please.
Answer:
B Sun > Algae > Shrimp > Red drum
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.
What statement is best supported by this information?
A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.
Answer:
B.
Explanation:
Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
Explanation: just did the test its right.
You splice DNA fragments from a "foreign" source into the patient's gene so that the gene will begin manufacturing the enzyme. The foreign DNA + the new DNA
Answer:
recombinant DNA
Explanation:
In molecular biology, recombinant DNA molecules are genetic sequences formed by combining DNA material from different sources (i.e., organisms, populations, species, etc). Proteins produced from DNA recombinant molecules are known as recombinant proteins. Molecular cloning is the most widely used technique in molecular biology in order to produce recombinant DNA molecules. In this technique, a cloning vector such as, for example, a plasmid of a bacterium, is used to insert a foreign DNA fragment into another cell which is then expressed in the host cell.
1. Would you consider a Zonkey (baby created from a donkey raised with a zebra) alive? Keep in mind that a Zonkey is sterile and cannot produce its own offspring.
2. Would you consider a virus alive? It requires a host completely to live.
Answer to 1:Yes the Zonkey is alive,not all organisms can reproduce. Some people are born with rare genetics were they can't give birth,so even if the Zonkey is sterile and can't produces it own offspring it is alive.
Answer to 2:Yes a virus is alive,it attacks the host and contains/kill other cells in your body. They also can multiple. If they can multiply and even attack and kill other cells they are alive.
20 points and brainliest! Explain how you got the answer!
Answer:
No of groups studied
As All other factors will effect the result ofvthe experiment.
But no matter how many groups you take to study they will show the same result
HOPE YOU GOT IT!
MARK ME AS BRAINIEST
lee and Celia are lab partners. While Celia pours a chemical into a graduated cylinder, some of the chemical splashed onto her arm . What should happen next?
Answer:
Celia should tell the teacher and wash her hands and arms twice.
Explanation:
She should tell the teacher because if she is unsure of what to do, the teacher can help her. If there is no teacher present, she should wash her hands and arms twice to remove as much of the chemical as possible. Then she should call a poison help or chemical help center if she is unsure of what to do next.
What is a significant benefit of studying fossils?
what is a cell that is the source of other cells
Answer:
stem cells
Explanation:
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
3. How does catastrophism explain how the fossil formed?
Answer:
Catastrophism, doctrine that explains the differences in fossil forms encountered in successive stratigraphic levels as being the product of repeated cataclysmic occurrences and repeated new creations. ... This doctrine generally is associated with the great French naturalist Baron Georges Cuvier
The mechanism of catastrophism directly explains the process of fossil formation. It described the natural history that has been punctuated by catastrophic events that altered the way life developed and rocks were deposited.
What is Catastrophism?Catastrophism may be defined as a type of geologic doctrine that significant changes in the earth's crust that have in the past been brought about suddenly by a series of events like mass extinction.
This catastrophic doctrine explains the differences in fossil forms encountered in successive stratigraphic levels as being the product of repeated cataclysmic occurrences and repeated new creations.
Therefore, the mechanism of catastrophism directly explains the process of fossil formation.
To learn more about Catastrophism, refer to the link:
https://brainly.com/question/24317565
#SPJ2
(Uhm help?) The law of conservation of energy states that when there is an energy transfer or transformation, energy is lost.
Assuming this is a true/false question, the answer would be false.
According to the law of conservation of energy, energy is neither created nor destroyed; it simply changes forms.
Unless you are saying that some energy would be lost as heat, This is true.
Answer:
ae you trying to find the meaning?
Explanation:
The law of conservation of energy states that energy can neither be created nor destroyed - only converted from one form of energy to another. This means that a system always has the same amount of energy, unless it's added from the outside. The only way to use energy is to transform energy from one form to another.
ex: the cue ball is shot at a stationary 8 ball. The cue ball has energy. When the cue ball hits the 8 ball, the energy transfers from the cue ball to the 8 ball, sending the 8 ball into motion. The cue ball loses energy because the energy it had has been transferred to the 8 ball, so the cue ball slows down.
please help with this question
Answer:
C
Explanation:
the answer is C bc I read this and u can site it in the text
Florida's land ecosystems include___________________. Check ALL that apply. *
prairies
forests
beaches
dunes
estuaries
Answer:
dunes, beaches, and maybe estuaries
Explanation:
i hope thats right.....
Compare the planets Mars and Saturn. Describe how their common characteristics are similar.
Answer:
Both Mars and Saturn have rings.
A plant is placed near a window. Instead of growing straight up, the plant grows to the side. What is this plant demonstrating? (1 point)
A)phototropism
B)dormancy
C)thigmotropism
D)gravitropism
A plant is placed near a window. Instead of growing straight up, the plant grows to the side. This plant demonstrates phototropism. Therefore, option A is correct.
What is phototropism?A plant can maximize photosynthetic light absorption in the aerial portion and water and nutrient uptake in the roots by using phototropism, or the differential cell elongation displayed by a plant organ in response to directed blue light.
Auxin is a hormone found at the ends of leaves and stems that reacts to light. It enables the plant to grow in a way that is favourable to the light source.
When a plant is placed near a window. Instead of growing straight up, the plant grows to the side. Then, this plant demonstrates phototropism. Therefore, option A is correct.
Learn more about phototropism, here:
https://brainly.com/question/24567669
#SPJ2
when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen
Answer:
Carbon dioxide
Answer:
Carbon Dioxide
Explanation:
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
Searches related to what are some of the factors foresters have to consider before making decisions? help meeeee
forest fires,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
Hydrogen ions are found in_____________
which hydroxide ions are found in_______
A. Acids and bases
B. Bases and acids
C. Acids and salts
D. Bases and salts
Answer:
A
Explanation:
found in acid and bases
why do atoms of the same element always have the same number of protons but sometimes have different mass number? What do you call these atoms?
Answer:
However, some helium atoms have more or less than two neutrons. Atoms with the same number of protons but different numbers of neutrons are called isotopes. Because the number of neutrons can vary for a given element, the mass numbers of different atoms of an element may also vary.
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
Which of the following is a requirement for a population to be in Hardy-Weinberg equilibrium?
A) The population must be very small
O
B) immigration must outpace emigration
O
C) each allele must be equally beneficial
O
D) There must be a high mutation rate
I think the answer is B. Immigration must outpace emigration. Hope this helps!
Hardy-Weinberg equilibrium is the principle of the genetic variation being constant. Each allele must be equally beneficial for a population to be in equilibrium. Thus, option C is correct.
What is the requirement of Hardy-Weinberg equilibrium?
Hardy-Weinberg equilibrium states the invariant nature of genetic variation when there are no disturbing factors in a population. For an equilibrium condition, the population should have a large size. Each allele must be equally beneficial so that there is no genetic drift.
There should be no immigration or emigration of the organism in a particular population as it affects the generation and individuals. Also, there must be no spontaneous mutations for the variation to occur.
Therefore, each allele must be equally beneficial for equilibrium.
Learn more about Hardy-Weinberg equilibrium here:
https://brainly.com/question/16823644
#SPJ5