Can someone help me with this one I would appreciate it very much!!

Can Someone Help Me With This One I Would Appreciate It Very Much!!

Answers

Answer 1

Answer:

12.5 pounds

Step-by-step explanation:

16 ounces = 1 pound

200 ounces = 1 × 200/16 = 12.5 pounds


Related Questions

PLS HELP MEE :((

Write an equation representing the area Felicia covered, y, in terms of the number of tiles she used, x.

y =

Answers

Answer:

Check the picture below

Step-by-step explanation:

1) Find the probability of rolling a
number greater than 3 on a standard
number cube.

Answers

Answer:

50%

Step-by-step explanation:

Perform the operation. (-4x^2-2x-6)-(-7x^2-2x-2)

Answers

Answer:

3x²-4

Step-by-step explanation:

1 distribute

(-4x²-2x-6)+7x²+2x+2

2 eliminate redudant parentheses

-4x² -2x - 6+7x² +2x+2

3 Add the numbers

-4x²-2x-4+7x²+2x

4 Combine like terms

3x²-2x-4+2x

5 Combine like terms

3x²-4

Answer:

[tex]3x^{2} -4[/tex]

Step-by-step explanation:

Before solving this you have to know that,

( - ) × ( - ) = ( + )

( + ) × ( + ) = ( + )

( - ) × ( + ) = ( - )

Let us solve now.

[tex](-4x^2-2x-6)-(-7x^2-2x-2)[/tex]

[tex](-4x^2-2x-6)+7x^{2} +2x+2[/tex]

[tex]-4x^2-2x-6+7x^{2} +2x+2[/tex]

Now combine like terms

[tex]-4x^{2}+7x^{2} -2x+2x-6+2[/tex]

[tex]3x^{2} -4[/tex]

Hope this helps you .

Let me know if you have any other questions :-)

How I can answer this question, NO LINKS, if you answer correctly I will give u brainliest!

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

Let's solve this using unitary method ~

[tex] \sf3 \: seconds = 63 \: meters[/tex]

[tex] \sf1\: second= 63 \div 3 \: meters[/tex]

[tex] \sf1\: second= 21 \: meters[/tex]

[tex] \sf5\: seconds= 21 \times 5 \: meters[/tex]

[tex] \sf5\: seconds= 105 \: meters[/tex]

Therefore , the ostrich will run 105 meters in 5 seconds.

Find the 82nd term of the arithmetic sequence —8, 9, 26, ...

Answers

N+17 , every sequence goes by that

82+17 = 99

ANSWER PLZZ NO LINKS PORFA

How many miles longer is Trail A than Trail B?

Answers

It is longer by 67 miles you just minus them

Autumn wants to invest $1000. The table below shows the value of her investment under two different options for three different years:

Number of years 1 2 3
Option 1 (amount in dollars) 1100 1200 1300
Option 2 (amount in dollars) 1100 1210 1331
Part A: What type of function, linear or exponential, can be used to describe the value of the investment after a fixed number of years using option 1 and option 2? Explain your reasoning. (4 points)

Part B: Autumn wants to invest in an option that would help to increase her investment value by the greatest amount in 7 years. Will there be any significant difference in the value of Autumn's investment after 7 years if she uses option 2 over option 1? Explain your answer, and show the investment value after 7 years for each option if the equation for option 1 is f(x)=100x + 1000 and the equation for option 2 is g(d) = 1000(1.1)d

Answers

Answer:

See below

Step-by-step explanation:

Part A

According the table, the yearly amount increases by 100 dollars in option 1 and 1.1 times in option 2.

It means the function is linear in option 1 and exponential in option 2.

Part B

Calculate the amount of total value in each case substituting x or d by 7 and compare the amounts:

f(7) = 100*7 + 1000 = $1700g(7) = 1000*(1.1)^7 = $1948.72 (rounded)

As we see the option 2 is better choice and the difference is:

$1948.72 - $1700 = $248.72

Classify the number -5
Integer

1. Whole Number

2. Irrational Number

3. Natural Number

Answers

Answer:

1. Whole number

Step-by-step explanation:

It's a negative number, but it is not a decimal, therefore it is a whole number.

solve for x and explain the steps:
3x-6=4(2-3x)-8x

Answers

Answer: x = 14/23

Step-by-step explanation:

3x-6=4(2-3x)-8x

3x-6=8-12x-8x --> Expand 4(2-3x)

3x-6=8-20x --> Collect like terms

3x-6+6=8-20x+6 --> Add 6 to both sides, to remove it from the right side

3x=-20x+14

3x+20x=-20x+14+20x --> Add 20x to both sides, to remove it from the left side

23x=14

[tex]\frac{23x}{23}=\frac{14}{23}[/tex] --> Divide both sides by 23

x = 14/23

= 3 and 1/2 × 3 and 1/2

Answers

Step-by-step explanation:

please mark me as brainlest

5(x-2)-3= 5x-13
help me plz​

Answers

X has infinity solutions.

Lester has 2 toy cars. Ivan has t times as many toy cars as Lester. Write an expression that shows how many toy cars Ivan has

Answers

Answer:

I=2t

Step-by-step explanation:

ivan has 2 times t

I WILL GIVE 30 POINTS TO THOSE WHO FILL IN THE BLANK CORRECTLY. A wire is needed to support a vertical pole 8 feet tall. The cable will be anchored to a stake 6 feet from the base of the pole. How much cable is needed?

Answers

Answer: The answer is 10 feet of cable.

What is the slope of this graph?
0.3
-3
los
1
3
3
1
2 3 4 5

Answers

Answer:

A

Step-by-step explanation:

Use the formula rise/run. The rise, in this case, was 3 and the run was 1. There for it would be 3/1 which is simplified to 3.

Simplify (y²z⁴)³ and explain answer

Answers

Answer:

y^6 z^12

Step-by-step explanation:

When the bases are the same that means that the powers on the inside can be multiplied by whatever is outside.

Hope this helps :)

WHAT DOES AN ANIMAL BREEDER DO?????????

I LITERALLY NEED HELP ON THIS ONE!!

Some school commercial thingy.

Answers

Answer:

Breeders cross animals of the same species with desirable traits to create desirable offspring.

Step-by-step explanation:

Can someone help me with these 2 problems I’ve been stuck on them for a very long time :’) tysm!!

Answers

Answer:

Christmas How many pouds this proportion to solve

A boat can travel 120 kilometers on 60 liters of gas. How far can it travel on 197 liters

Answers

Answer:

394 km

Step-by-step explanation:

197 is 197/60 times as much as 60

so the distance is also that much more: 120 km * 197/60 = 394

round 0.006772 to 1 significant figure

Answers

Answer:

0.007

Step-by-step explanation:

0's before other numbers are non-significant. Then you just round your number.

Hope that helps

Math is multi-cultural, analytical, timeless and hands-on. Provide a piece of mathematical concept, hypothesis, law, paradox, rule or theorem to prove this statement.

Answers

It should be noted that mathematics is multicultural. This implies that mathematics applies to different cultures.

Mathematics is multicultural and it's neutral from the issues of races, gender, class, etc. Also, it should be noted that mathematics is analytical.

Furthermore, mathematics is timeless and hands-on. This implies that students need to touch and feel what they're learning through a concrete experience.

Learn more about mathematics on:

https://brainly.com/question/12798024

helppppppppppppppppppppppppppppppppppppppp

Answers

4 in each and 2 left

Pls help! Will mark Branliest!! 50 points for whoever answers!!!!!!

Answers

Answer: See below

Step-by-step explanation:

Isolate x for x-2y+2z=9

3x=9+2y

[tex]x=\frac{9+2y}{3}[/tex]....(1)

Substitute (1) into the 2nd equation

[tex]\begin{bmatrix}-\frac{9+2y}{3}+3y=-4\\ 2\cdot \frac{9+2y}{3}-5y+3z=16\end{bmatrix}[/tex]

[tex]\frac{3\left(-9+7y\right)}{3}=3\left(-4\right)[/tex]

7y=-3

y=-3/7

Substitute y=-3/7

[tex]\begin{bmatrix}3z+\frac{18-11\left(-\frac{3}{7}\right)}{3}=16\end{bmatrix}[/tex]

[tex]\begin{bmatrix}3z+\frac{53}{7}=16\end{bmatrix}[/tex]

Isolate z by substituting it

[tex]3z+\frac{53}{7}=16[/tex]

[tex]\frac{3z}{3}=\frac{\frac{59}{7}}{3}[/tex]

[tex]z=\frac{59}{21}[/tex]

For x =9+2y/3 substitute z=59/21 and y=-3/7

[tex]x=\frac{9+2\left(-\frac{3}{7}\right)}{3}[/tex]

[tex]x=\frac{19}{7}[/tex]

[tex]x=\frac{19}{7},\:z=\frac{59}{21},\:y=-\frac{3}{7}[/tex]

Answer:

(1, - 1, 3 )

Step-by-step explanation:

x - 2y + 2z = 9 → (1)

- x + 3y = - 4 → (2)

2x - 5y + 3z = 16 → (3)

Add (1) and (2) term by term to eliminate x

y + 2z = 5 → (4)

Multiply (2) by 2

- 2x + 6y = - 8 → (5)

Add (3) and (5) term by term to eliminate x

y + 3z = 8 → (6)

Subtract (6) from (4) term by term to eliminate y

- z = - 3 ( multiply both sides by - 1 )

z = 3

Substitute z = 3 into (4)

y + 2(3) = 5

y + 6 = 5 ( subtract 6 from both sides )

y = - 1

Substitute y = - 1, z = 3 into (1) and solve for x

x - 2(- 1) + 2(3) = 9

x + 2 + 6 = 9

x + 8 = 9 ( subtract 8 from both sides )

x = 1

solution is (1, - 1, 3 )

what is 2/3 x 9/8 as a fraction in simplest form

Answers

Answer: [tex]\frac{3}{4}[/tex]

Have attached the picture for explanation...

The product of the fraction in the simplest form is 3/4

What is a fraction?

A fraction is a figure that is not a whole number. A fraction usually has a numerator and a denominator. The numerator is the number above. While the denominator is the number below.

What is the product of the fraction?

2/3 x 9/8 = 18/24 = 3/4

To learn more about multiplication of fractions, please check: https://brainly.com/question/1114498

Help plz im on a timer at school

Answers

Answer:

it is reduction so the answer is B.

Step-by-step explanation:

Help me with this pleassssseeeedeeeeeeee..

Answers

We’re told that QR and RS are equal, so this is an isosceles triangle.

Meaning the two base angles must also be equal

Using this information, we know that the third angle must be 180 - (22 + 22), since the angles in a triangle add up to 180

What is -7w-4-5w+13 simplified?

Answers

-12W+9
It’s right I am an algebra 1 teacher

Find the slope of the line that passes through the points given in the first column and match them with the appropriate result. (10,7) and (1,2)\left(10,7\right)\ and\ \left(1,2\right)(10,7) and (1,2)

Answers

Answer:

                                         

Step-by-step explanation:

1) The slope of line with the coordinate points (10, 7) and (1, 2) is [tex]\frac{5}{9}[/tex].

2) The slope of line with the coordinate points (9, 9) and (1, 16) is [tex]-\frac{7}{8}[/tex].

3) The slope of line with the coordinate points (9, 3) and (2, 1) is [tex]\frac{2}{7}[/tex].

4) The slope of line with the coordinate points (8, 8) and (1, 2) is [tex]\frac{6}{7}[/tex].

The slope of the line is the ratio of the rise to the run, or rise divided by the run. It describes the steepness of line in the coordinate plane.

The formula to find the slope of a line is slope = [tex]\frac{(y_2-y_1)}{(x_2-x_1)}[/tex]

From the given table, we have

1) The coordinate points are (10, 7) and (1, 2)

Here, slope [tex]=\frac{(2-7)}{(1-10)}[/tex]

[tex]=\frac{5}{9}[/tex]

2) The coordinate points are (9, 9) and (1, 16)

Here, slope [tex]=\frac{(16-9)}{(1-9)}[/tex]

[tex]=-\frac{7}{8}[/tex]

3) The coordinate points are (9, 3) and (2, 1)

Here, slope [tex]=\frac{(1-3)}{(2-9)}[/tex]

[tex]=\frac{2}{7}[/tex]

4) The coordinate points are (8, 8) and (1, 2)

Here, slope [tex]=\frac{(2-8)}{(1-8)}[/tex]

[tex]=\frac{6}{7}[/tex]

Therefore,

1) The slope of line with the coordinate points (10, 7) and (1, 2) is [tex]\frac{5}{9}[/tex].

2) The slope of line with the coordinate points (9, 9) and (1, 16) is [tex]-\frac{7}{8}[/tex].

3) The slope of line with the coordinate points (9, 3) and (2, 1) is [tex]\frac{2}{7}[/tex].

4) The slope of line with the coordinate points (8, 8) and (1, 2) is [tex]\frac{6}{7}[/tex].

To learn more about the slope of a line visit:

https://brainly.com/question/14511992.

#SPJ3

You are virtually racing against your friend who lives on Spain where they use the metric system. You measured that you ran 430 feet per minute and your friend measured that they ran 6.5 kilometers per hour. Which of you is faster?

Answers

Pretty sure the friend ran faster (wait for more answers I’m not sure)

benny uses 2/5 grams (G) of toothpaste each time he brushes his teeth. If benny buys 30-g tube, how many times will be able to brush his teeth?

Answers

Answer:

75

Step-by-step explanation:

First divide 2/5 to get 0.4. Then divide 30 by 0.4 to get the answer. A simple way to think about it is how many 0.4 grams are in 30 gram tube.

Jeremy got a haircut and paid 15% as a tip. What percent of the cost did Jeremy pay the barber, including the tip?

Answers

The percentage of the cost that Jeremy will pay including the tip paid is 115% of the cost.

Assuming the cost was $100 and Jeremy gave a 15% tip. The total he would pay is:

= 100 + tip

= 100 + (100 x 15%)

= $115

In percentage this is:

= 115/100 x 100%

= 115%

In conclusion, Jeremy would pay 115% of the tip.

Find out more at https://brainly.com/question/22444616.

Other Questions
Which feudal leader was responsible for laying the foundation for the European civilization following the fall of the Roman Empire? A:Charalemange B: Wiliam the conqueror Tropical dried fruit costs $1.50 per pound and regular dried fruit costs $0.90 per pound. You want to create a mixed bag of tropical dried fruit and regular dried fruit that is worth $1.30 per pound. How many pounds of tropical dried fruit do you need if you have already purchased 50 pounds of regular dried fruit? EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N]