24. Four identical rocks four four identical rocks were dropped into a stream and were
washed downstream. Which of the rocks below was prob-
ably transported the least distance.

24. Four Identical Rocks Four Four Identical Rocks Were Dropped Into A Stream And Werewashed Downstream.

Answers

Answer 1
rock #3 because it’s one of the bigger ones and it is also a rectangle shape making it more difficult for it to just roll on down
Answer 2

Less distance may be traveled with grains whose sizes are greater and more erratic. This is because as a stream moves downstream, its velocity progressively diminishes, causing the big and irregular grains to settle the first, hence option 3 is correct.

How are sediments transported?

Both a reduction in particle size and rounding of initially angular pieces are effects of the protracted transport of material by water and wind current. The grains get smaller and more spherical the farther they have to travel.

Erosion, transport, and deposition all result in the formation of sedimentary rocks. A sediment's grain size provides crucial details on (1) the agent that caused the erosion/transport of the sediment and (2) the current's speed.

Therefore, as a stream moves downstream, its velocity progressively diminishes, causing the big and irregular grains to settle the first, hence option 3 is correct.

Learn more about the sediments, here:

https://brainly.com/question/16526541

#SPJ2


Related Questions

from his monohybrid crosses, Mendel developed his first law

Answers

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

Using the data provided, how can we describe the difference between amplitude of an average wave in location B?



Compared to location A, an average wave in location B

A.
has more distance between it and the next wave.

B.
has less energy.

C.
is higher from the bottom to the top of the wave.

D.
has less distance between it and the next wave.

Answers

Answer:

has less distance between it and the next wave

The answer is d has less distance between it and next wave

18. Viruses are considered
because they can not perform the characteristics of life without a
19. Viruses are made of two basic compounds,
and a
made of protein.
20. A virus infects a cell by injecting
into a cell.

Answers

Answer:

6. antibodies and DNA for the question no.6

Please help me on this question

Answers

the first one goes with pollutes groundwater , the second one goes with harms aquatic creatures & the last one goes with destroys animals habitats .

AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.

Answers

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.

1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.

In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.

2. In the given set, the possible amino acid sequences can be given as:

Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.

In the given sequence:

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.

To know more about codons, refer to the following link:

https://brainly.com/question/19153211

4.
What is the importance of biodiversity to humans and to ecosystems?

Answers

Answer:

Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.

Explanation:

looked it up

What phase is mitosis in

Answers

Answer:

prophase, prometaphase, metaphase, anaphase, and telophase.

Explanation:

A geneticist crossed pure breeding black mice with pure breeding brown mice. All the mice in the F1 generation had black coats. When these mice were crossed, they yielded 961 black coated mice and 317 brown coated mice.

Fill in the new combinations of alleles in the F2 generation.

Answers

Answer:

The correct answer is - the brown allele is not independent from the black allele and disappears in the F1 generation.

Explanation:

IN this question it is given that there is a cross between pure black and pure brown breed and the F1 generation has all-black coat offspring and their self cross produced 961 black and 317 brown.

The black coat offspring is three times than the brown coat offspring in F2 generation which means they have 3:1 ratio that comes in the self cross of heterozygous only there for the F1 generation black coat offspring have the heterozygous genotype for the trait,

Thus, the brown allele is not independent of the black allele and disappears in the F1 generation.

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

When does gamete production occur?

Answers

Gametes are formed through meiosis, in which a germ cell undergoes two fissions, resulting in the production of four gametes. During fertilization, male and female gametes fuse, producing diploid

an atom that has gained or lost one or more electrons

Answers

This is called an ion. :)

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment. What relationship is shown here between the mistletoe and the tree?

A.Competition
B.Parasitism
C.Mutualism
D.Commensalism

Answers

The answer is B.Parasitism

Mistletoe extracts water and nutrients from the spruce, to the spruce tree's detriment. The relationship that is shown here between the mistletoe and the tree is Parasitism. Hence, the correct option is B.

What is Parasitism?

Parasitism refers to a type of symbiotic relationship in which one organism benefits at the expense of the other organism, which is called host. The parasite lives on or inside the host and derive nutrients as well as shelter from the host, thereby providing no benefit to the host in return.

Examples of parasites includes tapeworms, roundworms, lice, fleas, and some species of bacteria and viruses.

Parasitism is a common for of symbiosis in nature and play an important role in shaping the relationships between species and maintaining balance in ecosystem. Hence, the correct option is B.

For more details regarding parasitism, visit:

https://brainly.com/question/29759870

#SPJ6

How does sexual reproduction increase the variance of traits in a population?

Answers

Sexual reproduction provides genetic diversity because the sperm and egg that are produced contain different combinations of genes than the parent organisms. ... Sexual reproduction involves meiosis, which is the process of a cell doubling its DNA, shuffling its genes, and then dividing the shuffled DNA among four cells.

Select the group of organelles that is common to both plant cells and animal cells.
A.
cell wall, cell membrane, mitochondria
B.
cell membrane, mitochondria, cytoplasm
C.
cytoplasm, mitochondria, cell wall, nucleus
D.
nucleus, cytoplasm, chloroplasts

Answers

It would be B because both plants and animals both have that in their cells

Answer:

B

Explanation:

Both cells have cell membranes, mitochondria ( they both do cellular respiration), and cytoplasm for structure

why would an athlete need to be concerned about a twitch or sustained contraction​

Answers

Answer:

why an athlete would need to be concerned about twitches or contractions is because, whenever they perform, and such thing happens, it will most likely distract the athlete, and cause the athlete doing his/her performance to not be as good, and may lead to failure, for example, when someone is running very fast for a sprinting race, and he has a contraction in his leg it will cause him to react by showing signs of pain by slowing down or even tripping and falling, causing him to lose the race.

Hope this Helped!

what he said gll :))

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

Can someone pleeaseeee helpppp!! I’ll mark the brainliest

Answers

Answer:

i think its C im not sure but normally in my opinion that would be correct

Answer:

natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution

Explanation:

18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.

Answers

Answer:

B. Fewer pesticides are needed because of parasitoids.

Explanation:

Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation.  Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.

Sean and Catherine have 4 kids. Each kid has a different blood type. The public immediately assumes that Sean couldn't be the father. is this necessarily true? Use Punnett squares to show your work for if it is possible for them to have these 4 kids.
PLEASEEEE HELPPP!!!!!

Answers

It’s not necessarily true!

Here’s an example I drew out!

As Sean and Catherine have four kids and each is different blood type. The public assumes Sean as father and Catherine as mother which is not  necessary true.

The Puneet square is a helpful method to predict the variations and probability of cross-breeding. There could be possibly four changes such as blood group of Sean is A and Catherine is B then. Dominant blood group be found AA, AB, A an B blood group.

Learn more about Catherine have 4 kids.  

brainly.com/question/20757353.

O research existing data on accidents involving cars
communicate the results by telling everyone about the prototype
Question 3 (1 point)
There is a set number of times you should go through the engineering design process
- if your design isn't working by the 3rd time through, it's time to just quit and give
up.
True
False
To

Answers

Answer:

false

Explanation:

you fix your design to make it work that is what being is all about if it doesn't work you don't give up you figure out what is wrong and fix it.

Select all that apply.


The first known pandemic in A.D. 542, struck which parts of the world?



Australia

Middle East

North America

South America

Asia

North Africa

Europe
PLEASE ANSWER CORRECTLY

Answers

I think it's Asia.....

What is the net ATP gain at this stage of cellular respiration?
2
4
32
36

Answers

Answer:

The answer is A.) 2, Edge 2022

Explanation:

The net ATP gain at this stage of cellular respiration is 36. Therefore, option "D" is correct.

What is cellular respiration?

A series of chemical reactions known as cellular respiration breaks down glucose into ATP, which can be used as energy to power numerous body processes. Cellular respiration has three main stages: the citric acid cycle, glycolysis, and oxidative phosphorylation.

In eukaryotes, the 4 phases of cell breath incorporate glycolysis, progress response (pyruvate oxidation), the Krebs cycle (otherwise called the citrus extract cycle), and oxidative phosphorylation through the electron transport chain.

Therefore, cellular respiration is the main process that generates ATP and gives energy to the body to work.

Learn more about cellular respiration, here:

https://brainly.com/question/29760658

#SPJ7

Please pleaseeee helppppp I’ll mark the brainliest!!!

Answers

Answer:

the first option is correct

Explanation:

Answer:

the lest one

Explanation: darwen belived

The purpose of mitosis includes all of the following EXCEPT
A)repair of tissue in an injury cause by a burn

B) formation of a sex cell

C)replacement of cells removed by skinned knee

D)lengthening the long bones of a child

Answers

The answer is B.
Sex cells are formed by a process called meiosis, not mitosis.

explain the process of digestion abd absorption of carbohydrates.​

Answers

Answer:

Carbohydrate digestion breaks down disaccharides (sugar) and complex carbohydrates into a simpler sugar so it can be absorbed. But not all are completely absorbed in the small intestines.

Explanation:

if you do not contact your loan servicer to select another option, your Federal student loans will default to standard repayment, which has a term of

Answers

Answer: 10 years

Explanation:

When the student is not able to pay the loan on regular basis then the repayment plan is available that is called standard repayment plan. It is a kind of default plan for all and most kind of student loans. In this the monthly payment is broken down of an amount of $50 which is the minimum amount for loan pay for the duration of maximum 10 years. This payment plan helps to lower down the interest money on the payments.

What is relationship between genes dna and proteins

Answers

Answer:

genes are created by proteins. dna is created by genes

Explanation:

Most genes contain the information require to make proteins. The journey from gene to protein is one that is complex and controlled within each cell and it consists of two major steps – transcription and translation. Together, these two steps are known as gene expression.

Which relationship is an example of commensalim?

Answers

One of the most poplar examples of commensalism is the relationship between cattle egrets and livestock. The cattle egret is a common species of heron that is found in most regions of the world, and is mostly seen moving along with herds of cattle. This bird moves about in pastures, and follows livestock such as cattle and horses.

I WILL GIVE BRIANIEST
Fertilized eggs from the same species of sea turtle were incubated at different temperatures.
The hatchling data is shown in the table below.
Egg incubation temperature


Egg incubation temperature
# eggs used
# of embryos that died
# of hatched males
# of hatched females
26
∘^\circ

degrees
C
100
80
0
20
28
∘^\circ

degrees
C
100
4
0
96
30
∘^\circ

degrees
C
100
3
0
97
32
∘^\circ

degrees
C
100
2
13
85
34
∘^\circ

degrees
C
100
6
94
0
36
∘^\circ

degrees
C
100
86
14
0


Which of the following is supported by the data?

A

Female sea turtles develop at higher temperatures.

(Choice B)
B

The sex of sea turtle offspring depends on the incubation temperature.

(Choice C)
C

The largest number of male sea turtles will develop at 28





(Choice D)
D

Most of the sea turtle eggs hatched if incubated at 26

Answers

Answer:

Choice B i had this question a long time ago ;)

Explanation:

Answer:

The sex of sea turtle offspring depends on the incubation temperature.

Explanation:

1.) In low incubation temperatures (26°C) and high incubation temperatures (36°C), a large number of sea turtle embryos die.

2.) In temperatures 30°C and below, no males hatch, and in temperatures 34°C and above, no females hatch. This suggests that the sex of the hatchlings is affected by incubation temperature.


3.) The correct answer is: The sex of sea turtle offspring depends on the incubation temperature.

Other Questions
What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow) Ill mark you a branilyst if you answer this question Two charged objects originally felt 12N of attraction. One charge is changed from to 3C to 6C and their distance changes from 15cm apart to 45cm apart. What is the new force of attraction ? please help ill mark you Which of the following is a method used to obtain the relative age of a rock or fossil? aDecay rates bRadiometric dating cSuperposition dUniformitarianismi know its not radiometric dating Please help me I need it it is my last question help me , my project is do soon . You will most likely be working with a small business during your internship. Please describe some of the unique challenges you think a small business faces and how you would contribute to that work environment. Which of the following equations best represents the regression line for the data given in the table above? Hey can anyone come help with this?it's actually pretty easy but ima still ask In a tropical rain forest, tall trees crowd together, blocking the path of sunlight to the wet forest floor. Among the plants adapted to these conditions are climbers, such as vines that grow up along the tree trunks. Other plants, such as orchids, grow attached to tree branches and are not rooted in the ground. Even a small area of forest provides various habitats for vast numbers of animal and plant species. Many insects and birds are plant pollinators. Fruit-eating animals, such as birds and bats, spread seeds. Insects, fungi, and bacteria break down plant and animal matter, releasing nutrients into the soil. Predators, such as jaguars and snakes, feed on smaller animals.Tell how a biotic living thing relies on another biotic living thing.Tell how an biotic living thing, relies on an abiotic factor.Sentence Starters:1) A living thing like ______________ relies on a ________________ because2) A biotic living thing like _______________ relies on an abiotic factor like _____________ because....4PointsPlease provide at least 4 complete sentences for these answers.