16. Which of the following most directly
contributed to the Union victory in the Civil
War?
(A) The assassination of Lincoln turned public
opinion against the Confederacy
(B) The Union possessed greater resources and
population
(C) European nations ultimately intervened on
behalf of the Union
(D) The Confederacy failed to recruit effective
military leaders

Answers

Answer 1
The answer to this is b

Related Questions

Which statements about Songhai are correct?
Choose all answers that are correct.

A) During the reign of Askia Muhammad, the Songhai empire reached its greatest size.

B) Mansa Musa developed Songhai’s trade with Islamic empires to the north.

C) Songhai leader Sunni Ali conquered Mali and destroyed the city of Timbuktu.

D) Leo Africanus was Songhai’s ambassador to Cairo, Egypt.

Answers

Statements about Songhai that are correct are;

During the reign of Askia Muhammad, the Songhai empire reached its greatest size.

Songhai leader Sunni Ali conquered Mali and destroyed the city of Timbuktu.

What is Songhai empire?

Songhai empire can be regarded as great trading state of West Africa. It is period around the 15th and 16th century.

This trade is centred on the middle reaches of the Niger River. and this river is in Mali and it extends to Atlantic coast.

Askia Muhammad, was a leader in this empire, and Songhai empire reached its greatest size.

It should be noted that Mali was conquered by Songhai leader Sunni Ali

Learn more at:

https://brainly.com/question/2439707

Answer:

During the reign of Askia Muhammad, the Songhai empire reached its greatest size.

Songhai leader Sunni Ali conquered Mali and destroyed the city of Timbuktu.Explanation:

The Native Americans felt that the land______

Need ASAP
will give brainliest

Answers

The Native Americans felt that the land was a communal resource. Hope this helped!


PLEASE HELP WHICH SENTENCE?

Answers

Answer: first one

Explanation:

please pick which one is right and I will give the correct answer the brainlest

Answers

Answer:

Absolute and qualified terms change the value of a statements. Absolute terms, such as 'only,' 'never,' or 'none,' make the statement the only possible version of a situation. Qualified terms, such as 'may,' 'possibly,' or 'some' allow for many versions of a statement to be true.

Explanation:

Answer:

none of the above

Explanation:

It should be companies

What is the main idea of Hayes’s statement?
A. He will let the South govern as it wishes.
B. He will only look out for Northern interests.
C. He will work to unite the interests of North and South.
D. He thinks that the division between North and South is important.
I think the Answer is "C".

Answers

Answer:

c

Explanation:

Answer:

C

Explanation:

Right on edg :)

Hope this helps!

Desperate Please Hurry, I WIll Mark Brainlist
Explain how the US is the peacekeepers of the world.

Answers

Answer:

The US is the peacekeepers of the world because they build partner countries' peacekeeping training, operational readiness, and sustainment capacity

Explanation:

Answer:

The US is the peacekeepers of the world because the country serves other countries and provides resources or support to other countries in times of war.

Explanation:

Hope this helps :)

who is aliveeeeeeeeeee​

Answers

Answer:

achoo!

Explanation:

disgusting (≧▽≦)

Identify some grievances addressed in the Declaration of Independence and then how they were "Fixed" in the U.S. Constitution?

Answers

Answer:

The sacred rights of mankind are not to be

rummaged for, among old parchments, or musty

records. They are written, as with a sun beam

in the whole volume of human nature, by the

hand of the divinity itself; and can never be

erased or obscured by mortal power.”

— Alexander Hamilton, 1775

“The basis of our political systems is the

right of the people to make and to alter

their Constitutions of Government. But the

Constitution which at any time exists, ‘till

changed by an explicit and authentic act of the

whole People is sacredly obligatory upon all.”

— George Washington, 1796

“The Declaration of Independence...[is the]

declaratory charter of our rights, and of the

rights of man.”

— Thomas Jefferson, 1819

Message fromthe Director

The Declaration of Independence and the

Constitution of the United States are the two most

important, and enduring documents in our Nation’s

history. It has been said that “the Declaration of

Independence was the promise; the Constitution

was the fulfillment.”

More than 200 years ago, our Founding

Fathers set out to establish a government based

on individual rights and the rule of law. The

Declaration of Independence, which officially

broke all political ties between the American

colonies and Great Britain, set forth the ideas and

principles behind a just and fair government, and

the Constitution outlined how this government

would function. Our founding documents have

withstood the test of time, rising to the challenge

each time they were called upon.

Make no mistake, we have been presented with

a timeless framework for self-government, but in

order to preserve this wonderful gift, we must hold

these principles close to our hearts. I encourage you

to read and understand these documents. I promise

you will be nothing short of inspired.

Director

U.S. Citizenship and Immigration Services

Explanation:

Write a 500-word essay analyzing and evaluating US Democracy. ● What was the historical context for the US Founding Fathers’ desire for a new form of government? What were they trying to get rid of? What did they include in our Constitution to ensure that we thrived? ● Identify two ways in which the Founding Fathers neglected to adequately protect the rights of everyone. Hint: look at Constitutional Amendments to see how the US has started to remedy their shortcomings. ● Contrast the US Democracy with any other form of government. Find two distinctions and evaluate their strengths vs. weaknesses. Provide explanation for your analysis.

Answers

To write an essay analyzing and evaluating democracy in the United States, it is necessary to understand some fundamental historical contexts, such as the desire for freedom in order to achieve American independence.

The settlers were trying to free themselves from the rule of the British colonizers, which culminated in the American Revolution, which transformed the US into a unified, independent, republican and federalist country.

Through the American Constitution, it was established to create a balance between the centralized power of the president while guaranteeing the autonomy of states, preventing the government from becoming a tyranny, but rather a democracy.

US democracy has several strengths compared to other, more protectionist forms of government. Some advantages of democracy are:

EquityGovernance through voteFreedom of expressionSovereignty of the people

Therefore, democracy is a system that guarantees that all citizens are equal before the law, and all have an active role in government decisions, directly or indirectly.

It is essential that there is awareness of the political role of the citizen to achieve a fairer society for all.

Find out more information about US Democracy here:

https://brainly.com/question/16248459

In one paragraph, explain why European nations colonized Africa in the later decades of the nineteenth century.

Please make it make sense ! For Final

Answers

Answer:

The reasons for African colonisation were mainly economic, political and religious. During this time of colonisation, an economic depression was occurring in Europe, and powerful countries such as Germany, France, and Great Britain, were losing money.

Explanation:

hope it helps


Why was the Gupta Empire considered the Golden Age of India? Use examples in your answ

Answers

Answer:

This period became known as the Golden Age of India because it was marked by extensive inventions and discoveries in science, technology, engineering, art, dialectic, literature, logic, mathematics, astronomy, religion, and philosophy.

Explanation:

(ಥ _ ಥ)

What is an oligarchy?

Answers

Answer:

small group of people having control of a country, organization, or institution.

Explanation:

small group of people or something like that

The Colonists voting for their own
leaders would be an example of which of
the following?
A. divine right
B. popular sovereignty
C. parliamentary powers

Answers

Answer: popular sovereignty

Explanation:

Just the only good guess I could think of.

Popular sovereignty is the correct answer in this case. Popular sovereignty is the basic principle of modern representative democracy that maintains that the source of all governmental power resides in the people, who have the right to choose their own leaders.

The answer is B.

This can be done through direct or indirect voting methods. The Colonists voting for their own leaders would be an example of popular sovereignty, as it would be the people’s will that would determine who their leader was.

This is opposed to the other answer options, such as divine right, which is the belief that a monarch or leader has the right to rule because of a mandate from a higher authority. Parliamentary powers, on the other hand, refer to the power of governmental leaders to pass laws, create budgets, and allocate resources.

To know more about Parliamentary powers , click here:

https://brainly.com/question/30543716

#SPJ3

why do you think the text makes a particular point of listing the percentage of women involved in various branches of the military?

Answers

When there is a statistical overview of various factors which are used to show the percentage of people or how frequently something occurs in a distribution.

With this in mind, we can see that if there is a percentage of women in a given distribution such as in the various branches of the military, then we can see that this shows either how they are more frequently or less frequently.

In conclusion, if there's a higher percentage of women in the military compared to earlier years, then we can see that more women are getting involved in the military than other years.

Please note that your question is incomplete so I gave you a general overview to help you better understand the concept.

Read more about percentages here:

https://brainly.com/question/16865197

how did river valley civilizations influence classical civilizations

Answers

Answer:

River valleys (Summer of Mesopotamia, Egypt, Indus, and Huang He (Yellow River) China helped to shape the later classical civilizations (meaning Greece, Rome, Persia, etc.). Social stratification (hierarchies) are all examples of how river valley civilizations influenced the classical civilizations.

Explanation:

Based on what you have learned about Luke's background, what influences would have had a shaping force on Luke's writing? Consider at least three. 50 points

Answers

Answer:

Luke's writing was influenced by his background of being a physician. Luke was also Greek, so he didn't come from the circumcision. He was educated at a great learning center named Tarsus.

Explanation:

The fact that Luke was a physician as well as a gentile accounts for his emphasis on healing miracles and the spread of the gospel among the gentiles.

Luke is a physician who accompanied Paul on his travels. From Luke's account in the acts of the Apostles, we can see that Luke was not of the circumcision hence he took out a lot of space to explain the spread of the gospel among the gentiles.

Hence, the fact that Luke was a physician as well as a gentile accounts for his emphasis on healing miracles and the spread of the gospel among the gentiles.

Learn more: https://brainly.com/question/24936069

What do you understand by ‘Greater India’? How did Indian culture expand beyond Indian boundaries?

Answers

When one speaks of Greater India, they refer to the Southeast Asian countries that have all being influenced by Indian Culture.

Many countries in Southeast Asia went through a process of Indianization where cultural practices from India were induced into their society.

A lot of this happened as a result of:

Spread of religion - with the spread of Hinduism, Buddhism, and Islam to other kingdoms and nations, more Indian culture was adopted Conquest - Indian kingdoms or those based in India, were able to conquer portions of the Southeast and carry along Indian culture

In conclusion, Greater India is in Southeast Asia and resulted from Indianization.

Find out more about spread of religion at https://brainly.com/question/2366344

Propose a different name for the Silk Road and cite reasons
for your suggestion. Write your proposal in the paragraph
below.

Answers

Answer:Propose a different name for the Silk Road and cite reasons for your suggestion. Featured Sources. Featured Sources. Featured Sources. Featured Sources. Source ...

Missing: proposal ‎| Must include: proposal

Explanation: your welcome

Write a summary about the Russian Revolution

Answers

Question:

Write a summary about the Russian Revolution

Answer:

The Russian Revolution took place in 1917, during the final phase of World War I. It removed Russia from the war and brought about the transformation of the Russian Empire into the Union of Soviet Socialist Republics (USSR), replacing Russia's traditional monarchy with the world's first Communist state.

Explanation:

hope it helps

mark me as brainliest plss

Answer: The Russian Revolution took place in 1917, during the final phase of World War I. It removed Russia from the war and brought about the transformation of the Russian Empire into the Union of Soviet Socialist Republics (USSR), replacing Russia's traditional monarchy with the world's first Communist state. The revolution happened in stages through two separate coups, one in February and one in October. The new government, led by Vladimir Lenin, would solidify its power only after three years of civil war, which ended in 1920.

Based on courtly love songs and heroic legends, which attribute was most important for a knight? loyalty courage courtesy truthfulness.

Answers

Loyalty is the attribute that was most important for a knight, based on the courtly love songs and heroic legends.

Important attributes of love song and heroic legends:

The courtly love songs and the heroic legends are the famous quotes of the love stories. The love songs are the best part that describes the close bind between the two individuals.

The heroic legends show the bonds of protection towards loved ones or the ones whose responsibility is held on you.

Therefore, the correct answer is the first word.

Learn more about the love songs and heroic legends here:

https://brainly.com/question/759365

Answer:

a on edge

Explanation:

The war with Mexico
a. resulted in a large portion of territorial land going to Mexico.
b. resulted in the addition of territorial New Mexico to the U.S.
c. had no real impact on the history of the U.S.
d. happened after the Civil War.
Please select the best answer from the choices provided

Answers

Answer:

It’s b because the war ended with the treaty of Guadeloupe Hidalgo which settled the border of Texas (between Mexico and us territory) and stated that Mexico would have to cede territory to the us

Explanation:

Answer:

B

Explanation:

All of the other answers are incorrect

Land was not given to Mexico it was taken

The war did have an impact on the US

The civil war happened after the mexican american war.

Which states had the smalllest representatives in the house of representative

Answers

Answer:

Wyoming

Explanation:

The Wyoming Rule is a proposal to increase the size of the United States House of Representatives so that the standard representative-to-population ratio would be that of the smallest state, which is currently Wyoming.

which future u.s. president was captured by the british during the american revolutionary war?

Answers

Answer:

Thomas Jefferson and that is how the star springled banner

Explanation:

Many historians cite the theme of the Treaty of Versailles as “make Germany pay”. Give three examples that would give validity to this theme. Make a claim about whether or not this sets the stage for World War II and why. please be at least 1 paragraph

Answers

The Treaty of Versailles was an agreement in which it was established that Germany and its allies pay the consequences of the war by establishing that:

Germany and her allies had to accept moral and material responsibility for everything that happened. Germany should disarm (have no army) Germany and her allies had to pay compensation to the victorious countries of the war.

What was the Treaty of Versailles?

The Treaty of Versailles is one of the most important peace treaties in human history because it ended the First World War.

This treaty was signed in the Palace of Versailles (hence its name) on June 28, 1919 and entered into force on January 10, 1920. A characteristic aspect of this peace treaty was that it held the central powers, led for Germany for everything that happened. Additionally, it stipulated measures to compensate what happened, such as:

Germany had to accept full moral and material responsibility for causing the war. Germany had to disarm. Germany had to make important territorial concessions to the victorious states. Germany had to pay exorbitant financial compensation to the victorious states.

Learn more about Treaty of Versailles in: https://brainly.com/question/1800157

In 1973, an African-American woman, Shirley Chisholm, ran for the Democratic presidential nomination,
O True
O False

Answers

False, she ran in 1972 which made her the first woman to run for the Democratic Presidential

I need help because I think my answer is wrong . :(((

Answers

you’re correct
xxxxxxxxxxx

Answer:

your answer is absolutely correct.


What’s a country and it’s purpose?

Answers

An indefinite usually extended expanse of land : region miles of open country. 2a : the land of a person's birth, residence, or citizenship left their country for America. b : a political state or nation or its territory the country of Italy.

Explanation:

I dont know if im correct

so sorry if im wrong..

Advance Merry christmas!

On the War Front, soldiers needed to use water in order to cool down the machine
guns. In the absence of water, they used:
A) sand
B) snow
C) fans
D) urine

Answers

Answer:

If the machine gun had a wide mouth, the answer is B

If not, then the answer is D

Explanation:

This Victory Bonds poster makes references to the atrocities committed by the crew of a German submarine against the Llandovery Castle hospital ship. What message is
it hoping to communicate?

A)Support for war-efforts
B)More volunteers
C)Support for mistrust and mistreatment of Enemy Aliens.
D)Support for Income Tax increase.

Answers

Answer:

A

Explanation:

victory bonds is a way to support war efforts.

what beverage company has been using santa claus since 1931

Answers

Answer:

i think it is Coke

Explanation:

Other Questions
LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1 1. All the computer has a power button. Use the function below to find f(-2).f(x) = 5xO A. -25O B. 1/10O c. 1/25O D. -10 What is [tex]rs^{3}[/tex] divided by 8-2r if r=8 and s=3? A triangle has side lengths of 2 feet, 5.4 feet, and 5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Another triangle has side lengths of 3 feet, 8.1 feet, 7.5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Are the triangles similar? If so, what is the scale factor going from the top triangle to the bottom triangle?