Write an equation of the line passing through point (7,3) that is parallel to line 4x-7y=9

Answers

Answer 1

Answer:

y= 4/7x -1  

Step-by-step explanation:

solve for y first in 4x-7y=9, which becomes y = 4/7x - 9/7, then since its a parallel line the slope stays the same which is 4/7. Then plug into this equation: y =mx+b, in which you plug in the point for the x and y values and you plug in the slope for m, so the equation becomes, 3 = (7)(4/7) + b and now solve for b in which b = -1 and now write the equation using all the corresponding things so the equation becomes: y= 4/7x -1  


Related Questions

What is the slope of the line that passes through points E(6, 8) and F(6, - 2)

Answers

Answer is undefined. It's an undefined slope.

I need help please will markbrianlyest

Answers

240 people will go to the food pantry

The graph of a function is shown:

scatter plot of the points negative 5, 4 and negative 2, negative 1 and negative 1, 3 and 4, negative 3

Which of the following correctly identifies the set of outputs?

{–3, –1, 3, 4}
{–5, –2, –1, 4}
{(–5, 4), (–2, –1), (–1, 3), (4, –3)}
{(4, –5), (–1, –2), (3, –1), (4, –3)}

Answers

Answer:

{–3, –1, 3, 4}

Step-by-step explanation:

Answer:

the following correctly identifies the set of outputs?

{−3, −1, 3, 4}

Step-by-step explanation:

please help ill give brainleist
What is an equation of the line that passes through the point(2,−5) and is parallel to the line 6x+y=66x+y=6?

Answers

Answer:

An equation of the line that passes through the point(2,−5) and is parallel to the line 6x+y=6 is:

[tex]y=-6x+7[/tex]

Step-by-step explanation:

The slope-intercept form of the line equation

[tex]y = mx+b[/tex]

where m is the slope and b is the y-intercept

Given the equation

[tex]6x+y=6[/tex]

Writing in the slope-intercept form of the line equation

[tex]y = -6x + 6[/tex]

comparing with the slope-intercept form of the line equation

y = mx+b

Thus, the slope of line = m = -6

We know that the parallel lines have the same slopes.

Thus, the slope of the parallel line is also -6.

As the line passes through the point (2,−5).

Thus, using the point-slope form of the line equation

[tex]y-y_1=m\left(x-x_1\right)[/tex]

where m is the slope and (x₁, x₂) is the point

substituting the values m = -6 and the point (2,−5)

[tex]y-y_1=m\left(x-x_1\right)[/tex]

[tex]y - (-5) = -6 (x - 2)[/tex]

[tex]y+5=-6\left(x-2\right)[/tex]

subtract 5 from both sides

[tex]y+5-5=-6\left(x-2\right)-5[/tex]

[tex]y=-6x+7[/tex]

Therefore, an equation of the line that passes through the point(2,−5) and is parallel to the line 6x+y=6 is:

[tex]y=-6x+7[/tex]

Claire and her partner, Grace, are throwing for the javelin event as a team. Claire threw the javelin 42 ft. and Grace threw it 39 ft. How far did the team throw the javelin?

Answers

Answer:

42+39 or 81 feet

Step-by-step explanation:

add them up and you get 81 feet.

Hope this helps plz hit the crown :D

pleaase answer brainlest to anyone

Answers

Answer:

Put an open circle at h= 75.5

Draw an arrow at the circle going to the right.

You start at (-3, 0). You move right 4 units and up 1 unit. Where do you end?

Answers

Answer:

(1, 1)

Step-by-step explanation:

T divided by -4 equals nine

Answers

Answer:

54

Step-by-step explanation:

t/-4=9
1. multiply both sides by reciprocal of -1/4 *(-4)t/-4=9(-4)
2. solve *t=-36*
answer: t=-36

If f(x) = x, then f(64) is equal to

a. 1/4
b. -8
c. -4
d. 4

Answers

B hope it helps have a good day

What is the algebraic expression for 10 more than a number one s greater than 50

Answers

Answer (let x be the number):

x + 10 > 50

Step-by-step explanation:

Let x be the number

10 more than a number = x + 10Is greater than 50 = > 50Put them together: x + 10 > 50

I hope this helps!

X + 10 > 50 would be the answer

Henry was playing cards with some friends. He was winning 3 out of every 5 games. If he continues to win at this rate, how many games will he win if they play 75 games

Answers

Answer:

im jake paul

Step-by-step explanation:

team 10 is deade and i killed it i ate it

What is the measure of angle T in this triangle? Enter your answer as a decimal in the box. Round only your final answer to the hundredths place. m∠T= ° A right triangle, T R S. Hypotenuse is labeled 68 m. The shorter leg is labeled 32 m. The longer leg is labeled 60 m. The right angle is at angle S. Angle R is across from the 60 m side. Angle T is across from the 32 m side.

Answers

Answer:

Hey homie

Step-by-step explanation:

Here you are ;)

The measure of the angle ∠STR of the right-angle triangle ΔTSR will be 28.07°.

What is a right-angle triangle?

It's a form of a triangle with one 90-degree angle that follows Pythagoras' theorem and can be solved using the trigonometry function.

The hypotenuse is named 68 m. The more limited leg is named 32 m. The more drawn-out leg is named 60 m. The right point is at point S. Point R is opposite the 60 m side. Point T is opposite the 32 m side.

The measure of the angle ∠STR of the right-angle triangle ΔTSR is calculated as,

Let 'x' be the angle ∠STR. Then the equation is given as,

sin x = 32 / 68

Simplify the equation, then we have

sin x = 32 / 68

sin x = 0.470588

x = sin⁻¹(0.470588)

x = 28.07°

The measure of the angle ∠STR of the right-angle triangle ΔTSR will be 28.07°.

More about the right-angle triangle link is given below.

https://brainly.com/question/3770177

#SPJ2

Which pair shows equivalent expressions?

A. 2x + 10 = -2(x - 5)
B. -2(x + 5) = 2x -10
C. -2x - 10 = -2(x + 5)
D. -2(x - 5) = -2x - 10

Answers

Answer:

It's C

Step-by-step explanation:

When you multiply - 2 to what you have in the brackets you get - 2x - 10

Hope this helps, have a wonderful day

Need help
Given u = ⟨root3, -1⟩ and v = ⟨3, –4⟩, what is u · v?

Answers

Answer:

3[tex]\sqrt{3}[/tex] + 4

Step-by-step explanation:

If u = < x₁, y₁ >  and v = <x₂ , y₂ > , then

u • v = x₁x₂ + y₁y₂

Given

u = < [tex]\sqrt{3}[/tex], - 1 > and v = < 3, - 4 >, then

u • v = 3[tex]\sqrt{3}[/tex] + (- 1)(- 4) = 3[tex]\sqrt{3}[/tex] + 4

Y’all what should i do

Answers

Answer:

ummm pray and hope youll be fine?

The cost of 9 scarves is $87.75. What is the unit price?

Answers

Answer:

the answer is 9.75 for one

Step-by-step explanation:

divide 87.75/9

hope this helped

Solve for x in the equation x2 + 4x-4-8.
O x= -6 or x = 2
O x=-2+2V2
O x = -2 or x = 6
O x=2+25

Answers

Answer:

O x = - 6 or x = 2

Step-by-step explanation:

x² + 4x - 4 - 8 = 0

x² + 4x - 12 = 0

x² + 6x - 2x - 12 = 0

x(x + 6)x - 2(x + 6) = 0

(x + 6) (x - 2) = 0

x + 6 = 0 or x - 2 = 0

x = - 6 or x = 2

Thus, x = - 6 or x = 2

-TheUnknownScientist

Which of these is not a unit for measuring weight?
A
ton
B.
gallon
С
ounce
D
pound

Answers

I believe it is a pound. D

UREGENT‼️‼️
4. Find the slope of the line that passes
through the following pairs of points:

Answers

Answer:

A.-8  B.1/10

Step-by-step explanation:

a. -75--51=-24

     10-7=3

-24/3=-8

b. 12.5-10.5=2

    25-5=20

2/20=1/10

     

HELP MEE!!! Make sure to simply please

Answers

Answer:

YOUR CAMERA IS BAD I CANT SEE ANYTHING

Step-by-step explanation:

Answer:

1/5

Step-by-step explanation:

Elena is binding a small booklet with a spine that is 21/4 inches long. She uses staples that are 7/16-inch long. If she puts the staples end-to-end through the booklet, without gaps or overlaps between them, how many staples would it take to bind the booklet?

Answers

Answer:

12 staples

Step-by-step explanation:

So the first thing we have to do is find the G.C.D (Greatest Common Denominator) between 21/4 and 7/16 which of course is 16 so your new fractions would be 84/16 and 7/16.

Now we have to divide both numbers I just used a fraction calculator for this but basically you multiply 84/16 by the reciprocal of 7/16 which is 16/7 and simplify which equals 12.

So it would take 12 staples to bind the booklet

Expanding each integer in the expression 21 × 12, the result is [(2 × 101) + (1 × 100)] × [(1 × 101) + (2 × 100)]. Replace the 10s with x’s and then multiply this expression using FOIL. Compare it with the normal integer multiplication method used above: How are they similar? Show your work.

Answers

bxjabcbkbkebwjbckjwStep-by-step explanation:

Answer:

this is step up very weird could you set it up a bit clearer?

Step-by-step explanation:

I need help please very appreciate it

Answers

Answer:

x = 18.6

Step-by-step explanation:

I’m not going to show step-by-step on how I solved it, but the image below shows a triangle calculator that solved it.

Hope this helps! :)

six celebrity starring in a popular sitcom that has a 12-show season of each page $750,000 per episode additional cost of producing a sitcom total $275,000 per episode. A 12- show reality series cost $350,000 so produce each episode. What is the difference between the total cost to produce the sitcom and the reality series?
Answers: A is $53,100,000.00 B is $4,200,000.00 C is $57,300,000.00 and D is $61,500,000.00

Answers

Answer:

Choice A

Step-by-step explanation:

YW

What is $36 plus $36

Answers

Answer: The answer is 72

Step-by-step explanation:

12. Find DC showing step be step

Answers

DB= 20sin(54)
DB= 16.18
DC=16.18/sin(28)
DC=34.46

The length DC of the triangle ΔBDC using the trigonometric function will be 30.43 units.

What is a right-angle triangle?

It's a form of a triangle with one 90-degree angle that follows Pythagoras' theorem and can be solved using the trigonometry function.

Trigonometric functions examine the interaction between the dimensions and angles of a triangular form.

The length of BD is given as,

sin A = BD / AB

sin 54° = BD / 20

BD = 20 × sin 54°

Then the length of DC is given as,

tan C = BD / DC

tan 28° = (20 × sin 54°) / DC

DC = (20 × sin 54°) / tan 28°

DC = 20 × 1.5215

DC = 30.43 units

The length DC of the triangle ΔBDC using the trigonometric function will be 30.43 units.

More about the right-angle triangle link is given below.

https://brainly.com/question/3770177

#SPJ5

PLEASE HELPPPPP!!!!! WILL GIVE BRAINLIEST
If r represents the radius of a cylinder, what might the expression below represent? begin 2 πr cubed
A.
the volume of a cylinder whose height and diameter are equal
B.
the volume of a cylinder whose height and radius are equal
C.
the lateral area of a cylinder whose height and diameter are equal
D.
the lateral area of a cylinder whose height and radius are equal

Answers

Answer:

Step-by-step explanation: Equations representing direct, inverse, and joint variation are examples of ... When solving problems using rational formulas, it is often helpful to first solve the ... Now let's look at an example using the formula for the volume of a cylinder. ... is V = πr2h, where V is the volume, r is the radius and h is the height of the cylinder

If r represents the radius of a cylinder then 2πr³ can represent D. the lateral area of a cylinder whose height and radius are equal.

What is a cylindrical shape?

A cylinder is a three-dimensional solid object with two bases that are identically circular and are connected by a curving surface that is located at a specific height from the center.

Examples of cylinders are toilet paper rolls and cold beverage cans.

The volume of a cylinder is πr²h.

Lateral surface area = 2πrh.

Total surface area = 2πr(h + r).

Given, r represents the radius of a cylinder.

The expression 2πr³ can represent the lateral surface area of a cylinder whose height and radius are equal.

The lateral surface or curved surface area of a cylinder is 2πrh.

learn more about cylinder here :

https://brainly.com/question/16134180

#SPJ6

Convert the following equations from point-slope form to slope-intercept form.

9) y – 4 = 3(x – 1)

10) y – 1 = -4(x – (-3))

Answers

Answer:

We need to solve both for y.

#9:

[tex]y - 4 = 3(x - 1)\\\\y - 4 = 3x - 3\\\\y = 3x + 1[/tex]

#10:

[tex]y - 1 = -4[x - (-3)]\\\\y - 1 = -4(x + 3)\\\\y - 1 = -4x - 12\\\\y = -4x - 11[/tex]

Help!!!! 10 points Taking a test Micah invested $3450 in an account paying simple interest. At the end of 6
years, the value of his account was $3967.50. What was the interest rate? *
O a. 1.5%
O b. 2.0%
O c. 2.5%
O d. 15%

Answers

Answer:

The answer is C.

Step-by-step explanation:

First, you have to find the interest amount after 6 years. In order to do this, you have to subtract :

[tex]3967.50 - 3450 = 517.50[/tex]

Next, you have to apply simple interest formula, I = (P×R×T)/100 where I repesents interest amount, P is priciple, R is interest rate and T is number of years :

[tex]i = \frac{prt}{100} [/tex]

[tex]let \: i = 517.50,p = 3450,t = 6[/tex]

[tex]517.50 = \frac{3450 \times r \times 6}{100} [/tex]

[tex]517.50 = \frac{20700r}{100} [/tex]

[tex]51750 = 20700r[/tex]

[tex] \frac{51750}{20700} = r[/tex]

[tex]r = 2.5\%[/tex]

9. Which graph can be used to find the solution to the system of equations?
y = x-1
9y = 6x – 15

Answers

I used desmos and plotted the equations in. I would find which graphs cross one another at (-2,-3)
Other Questions
Though Shaka was a great African leader he was unable to keep his kingdom intact against the superiorweapons of the British. The Zulus became part of British controlled land in 1887. Many of the whiteImperialists believed it was their duty to then convert natives to western cultural values. The discovery ofdiamonds and gold in southern Africa created a world rush to exploit fortunes from these products for thecolonizers. The legacy of this time period is complex. The mixing of cultures has led to new culturalgroups such as peoples in Mexico with indian and Spanish blood. Colonization also led to the rise of manyruthless military leaders who had little experience with democracy or human rights leaving many colonizedareas struggling in the modern age.Select the best word because the paragraph mentions African leaderAssimilationNatural rights/EnlightenmentEconomicsPolitics/ExecutiveNatural ResourcesConquistadors/Absolute powerWhite Man's BurdenIndirect ruleBud A medium pizza at Benny's Pizza costs $13.60 plus $2.50 for each topping. At Ricco'sPizza, a medium pizza costs $14.60 plus $2 for each topping. For how many toppingswill the pizzas cost the same price?O 2 toppingsO They will always cost the same. 1 toppingO They will never cost the same. Please help! 20 points and brainly!!Which ratio forms a proportion with 14/42? 1/4 7/21 12/40 28/80(Please explain how you got the answer) What are all the secrets to the universe ? 25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)?