which structures of the cytoskeleton are found in animal cells

Answers

Answer 1

Answer:

Microfilaments, microtubules and intermediate filaments make up the cytoskeleton of animal cells. They are all made up of smaller protein units and can serve a variety of functions for the cell. From transportation to cell movement to support and structure, the cytoskeleton is an invaluable part of the animal cell.

Explanation:


Related Questions

the hershey and chase blender experiment was designed to

Answers

Answer:

Hershey and chase sought to determine if the replicating piece of phages that entered bacteria during infection, the genetic parts, were solely DNA.

Explanation:

#5 and 6 pleasee I will give you 100 points

Answers

6)it is bigger then we ever thought and that we wont beable to explore it all..

CORRECT ME IF I AM WRONG

6) it is bigger then we ever thought and that we wont beable to explore it all

sorry if this didnt help

what type of inheritance do two alleles have if their traits blend together?

Answers

Answer:

Explanation:

Codominance is when both dominant traits are expressed, therefore if white was considered dominant and red was also a dominant trait, the petals would have spots of white and red, with no pink. Polygenic inheritance is described by one characteristic influenced by multiple genes, which is not the case in this problem.

nucleic acids are assembled in the _____ direction.

Answers

5’ to 3’ hope this helps:)

Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.

What are Nucleic acids?

Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.

Learn more about Nucleic acids here:

https://brainly.com/question/11309892

#SPJ6

quién me ayudaría a hacer este crusigrama
gracias ​

Answers

Answer:

Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:

Explicación: 1.Venezuela

2. Sanclemente

3. Marroquin    

me das corona plis chau

Explanation:

which term describes the ability of neurons to process information, store and recall it, and make decisions?

Answers

Answer:

Neural Integration

Explanation:

:)

which muscle cells have desmosomes and gap junctions

Answers

Answer:

Cardiac muscle cells are rectangular-shaped cells connected by regions called intercalated discs. Intercalated discs contain gap junctions and desmosomes.

Explanation:

The muscle cells that have desmosomes and gap junctions are cardiac and smooth muscle cells. The correct option is C.

What is a cardiac cell?

Cardiac cells are the chain of myofibrils and look like a chain of rods. It is of red color. Cardiac muscle cell has three types of gap junction. The two types are sheet desmosomes and spot desmosomes.

The options are attached below.

Thus, the correct option is C. cardiac and smooth muscle cells.

Learn more about cardiac cell

https://brainly.com/question/14005473

#SPJ2

How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)

Answers

Answer:

A

Explanation:

easy - one giving brainly if correct AND DETAILED!
please give me at least 2.​

Answers

Well you see theres this guy named MrBeast thats taking little kids money and is having one of his slaves eat a water bottle for every dollar

Answer:

Well recently Team Seas has come out for every dollar donated I think it's 1 pound of trash so by donating would be one.

The second would be volunteering to help clean up for example a beach.

For more lasting impact would be to have a machine that collects the trash at where the rivers and streams meet the ocean this will lead to less trash in the ocean. There is a great example of this machine by Mark Rober gives a detailed explanation.

What bird is known in North America that makes domes shaped nests and lives in the western part of it?

Answers

Answer: Cowbirds lay eggs in a great variety of nests, including Red-winged Blackbird nests in marshes, dome-shaped Ovenbird nests on the forest floor, cup nests in shrubs and treetops, and even occasionally in nests in tree cavities.

A bar graph and a pie graph are the same thing.

A. True
or
B. False​

Answers

Falseee !!! I'm suree
B. False
Pie charts show how much each category represents as a proportion of the whole and Bar graphs use a series of rectangular bars to show absolute values or proportions for each of the categories

The following are the results of a genotype being "foiled" for a dihybrid cross: BS, Bs, bS, bs.

Determine the parents' genotype
A. BbSS
B. BBss
C. BsSs
D. BBSS

Answers

Answer:

C.

Explanation:

where are the proteins of the electron transport chain located in a eukaryotic cell?

Answers

Answer:

In eukaryotes, the electron transport chain is located in the inner mitochondrial membrane. In prokaryotes, it is located within the plasma membrane

Type your response in the box.
Do you think one gene controls human hair color? Explain your answer.

Answers

Do you think one gene controls human hair color?

No, this is false. Not only one gene is responsible for the colour of your hair, at least 2 gene pairs control human hair colour. Therefore, this is wrong since each parent contributes multiple hair-colour genes .

Hope this helped you, have a good day bro cya)

Answer:

There are many different phenotypes for hair color among humans. Therefore, multiple genes control hair color.

what kind of energy is necessary to initiate the process of photosynthesis?

Answers

Answer:

Light energy.

light energy or radiation

how does the plasma membrane contribute to the structure and function of the cell?

Answers

Answer:

The plasma membrane, also called the cell membrane, is the membrane found in all cells that separates the interior of the cell from the outside environment. ... The plasma membrane consists of a lipid bilayer that is semipermeable. The plasma membrane regulates the transport of materials entering and exiting the cell.

A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it moves hazardous materials out of the cell and carries nutrients into the cell.

What is a cell membrane?

All cells' interiors are protected from the outside world by a biological membrane called the cell membrane. A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it maintains a constant environment inside the cell, and that membrane serves a variety of purposes. One is to move substances out of the cell that are toxic as well as nutrients into the cell.

Glycerophospholipids, molecules made of glycerol, a phosphate group, and two fatty acid chains, are what make up cellular membranes, including plasma membranes and internal membranes.

Learn more about cell membrane, here:

https://brainly.com/question/13524386

#SPJ5

Kim's Dalmatian, Tigger, always eats the same brand of food. Although he does everything else at lighting speed, he is a very slow eater. After watching a TV commercial touting the irresistible taste of Puppy Yums Dog Vittles, Kim decides to conduct an experiment comparing Tigger's regular food (K-9 Crunchy Bits), Puppy Yums Dog Vittles, and a store brand that cost 1/3 as much as the advertised food. Kim gave Tigger the same quantity of each different food, on three successive evenings, and used a stopwatch to determine Tigger's dinner-time munching speed.

Hypothesis:
Predicted Results:
Independent Variable:
Dependent Variable:
Control Variable:

Answers

The experiment was intended to show that the dog will eat the tastier food advertised on TV at a faster rate than it eats its regular food.

An experiment must have an independent variable and a dependent variable. The dependent variable is the variable that is being manipulated in the experiment. The responding variable is also called the dependent variable.

In this experiment;

The independent variable is the type of dog foodThe dependent variable is the eating time of the dogThe predicted result is that the dog will eat the advertised Puppy Yums Dog Vittles faster than the other dog foodsThe control variable is the quantity of dog food given to the dog each evening.The hypothesis of the experiment is that the dog will eat the advertised tasty food faster than it eats its regular food.

Learn more: https://brainly.com/question/22824409

74 POINTS!!!!!!!!
Do you think we should attempt to
quantify and assign market values
to ecosystem services and other
entities that have only non-market
values? Why or why not?

Answers

Answer:

yes

Explanation:

yes because I like the same thing cuz you just like doing like what you have to do and I did it already and I got it a

5. What natural phenomenon converts nitrogen into the form which organisms can use?

Answers

Answer:

the nitrogen cycle

Explanation:

When two substances create a solution, what happens to its mass?
A.The mass is increased.
B.The mass is decreased.
C.The mass stays the same.
D.The mass disappears.

Answers

The mass is increased becuase you are adding two substances together, you are adding their individual masses together

which could take place by active transport A. the movement of carbon dioxide into a photosynthesising leaf B. the movement of carbon dioxide out of a respiring cell C. the movement of nitrate ions into a root hair cell D. the movement of oxygen into a respiring cell

Answers

Answer is C, Hope this helps!!

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

which statement is true about the nitrogen bases in dna and rna?

Answers

Explanation:

in DNA nitrogen bases are adenine, thymine, guanine and cytosine and in RNA nitrogen bases are same but instead of the thymine there's uracil

in DNA there are linked together adenine and thymine ; Guanine and cytosine. And in RNA adenine and uracil; Guanine and cytosine.

what do you call an organism that has been genetically engineered to contain a gene from a different species?

Answers

Answer:

A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.

Explanation:

Answer:

This would be called a transgenic or genetically modified organism.

Explanation:

A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.

The cell membrane is said to be semipermeable because

Answers

Answer:

The membrane is selectively permeable because substances do not cross it indiscriminately.

Explanation:

Tại sao con người chúng ta lại sốt nhiều lần như vậy?

Answers

Answer:

Fever is an elevated temperature of the human body that is substantially beyond the normal range. Normal body temperature fluctuates daily from about one degree below 98.6 degrees Fahrenheit to one degree above that number. Lower body temperatures usually occur before dawn; higher temperatures in the afternoon.

Body temperature also varies slightly depending on where on the human body it is measured. Rectal (internal) temperature tends normally to be higher than skin (surface) temperature. Oral and armpit temperatures can approximate actual body temperature and are more convenient to measure.

what is the role of microfilaments in cell division

Answers

Answer:

. Microfilaments help the cell lay down new membrane and divide into two daughter cells.

Explanation:

GUYS PLEASE HELP I HAVE SCHOOL TOMORROW AND THIS IS THE LAST QUESTION BEFORE I GET TO GO TO A HAUNTED HOUSE XD.
When a cell uses a ____ channel to get large molecules across the cell membrane this is known as ___ diffusion.
That's all it gives me two answers please. *PLEASE HELP*

Answers

Answer:

I'm pretty sure the bottom one is faciliated diffusion. Try searching up your answer so sorry I couldn't help more, but I hope that does help you out a bit:)

WHAT ARE THE IMPORTANCE OF TRANSPORT MECHANISMS IN CELLULAR PROCESSES?

Answers

To protect the cells internal environment and balance the nutrients and proteins that keep the cell alive


Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?

Answers

Answer:

water will move out of the cell,energy is required

Explanation:

water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.

Other Questions
Lance wrote down a lot of plus sevens and minus fours. Altogether he wrote 22 digits. When he came to add them all up the total was zero. How many plus sevens were there? Identify the central idea or claim thatDr. Martin Luther King, Jr. includes inI paragraph 21. Explain how his use of a rhetorical appeal supports that central idea. PASSAGE IS LETTER FROM BIRMINGHAM JAIL. Which line from "America" best conveys the idea that Whitmanbelieves America will care for and protects its citizens?1. Centre of equal daughters, equal sons,"2. Chair'd in the adamant of Time."3. Strong, ample, fair, enduring, capable, rich,"4. A grand, sane, towering, seated Mother." Lucy brought 4 of her scarves to a secondhand store to sell. She was paid the same amountof cash for each scarf. Before she left, Lucy spent $10.50 of her earnings on a used sweater.She had $7.50 remaining. What was the value of each scarf? where is the account accumulated depreciation on equipment found on the financial statements? 1.a computer can create an output based on the input of the user.process store retrieve communicate personal computer desktop computer laptop computer netbook tablet smartphone server game consoles PLEASE HELP WILL GIVE BRAINLY!!!!!!How has the use of the term "serial killer" changed in our society? Identify the rhyme scheme Read this passage from Phillis Wheatley's poem To the King's Most Excellent Majesty." Labeleach line with a letter to represent rhyme scheme by using the drop-down menus....The crown upon your brows may flourish long,And that your arm may in your God be strong!O may your sceptre num'rous nations sway,And all with love and readiness obey!But how shall we the British king reward!Rule thou in peace, and our lord!Midst the remembrance of thy favours past,The meanest peasants most admire the last..."To the Kings Most Excellent Majesty," Phillis WheatleyDONE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP Mario measured the depth of the river as a function of time and graphed his findings. Use this graph to answer the following question.What is the maximum depth of the river?1 meter22 minutes10 meters9 minutes Read this story to answer question.The American colonies had accomplished an amazing success. Angry about their treatment by the British government, the colonists had protested and then revolted. After winning the Revolutionary War against England, they had formed a new country: the United States of America.During the war, the Continental Congress had formed a government under the Articles of Confederation. This document served as the first constitution of the United States. Because of their experiences with the British government, the colonists had limited the power of the United States central government under the Articles. After the war, however, many people realized that the government had too little power. It could not collect taxes or regulate trade. There was no executive to enforce laws and no court system to make sure laws were fair. The countrys leaders realized the United States needed a new plan of government.Respected people, or delegates, from all the colonies except for Rhode Island met in Philadelphia in 1787 to create a new constitution. For four months the delegates discussed problems and solutionsin secret so that no one would influence the decisions. Finally, in September 1787, they completed the writing of the United States Constitution. The next step was to get the document ratified, or approved, by nine of the thirteen states. That task was not easy.When Americans learned the specifics of the Constitution, two groups formed. People who supported the strong government created by the Constitution were called Federalists. People who worried that the government would be too powerful were called Anti-Federalists. As the states prepared to ratify the Constitution, these two groups worked hard to get people to join their side. Leaders of the Federalists wrote a series of essays published throughout the country. They urged the states to ratify the Constitution without any amendments. Meanwhile, the Anti-Federalists wanted to make sure that peoples rights were protected against the government. It soon became clear that some statesespecially big states such as Massachusetts, New York, and Virginiawere not ready to adopt the Constitution.What were the rights that the Anti-Federalists wanted to protect? The list included the right to speak freely, to worship freely, to have fair searches, and to have a trial by jury. These were all rights that the British government had ignored before the Revolution. Federalists claimed that those rights were protected even though they were not specifically listed. After more than two years of discussions, James Madison proposed amendments, or additions, to the Constitution that would protect a citizens rights. What were the rights that the Anti-Federalists wanted to protect? The list included the right to speak freely, to worship freely, to have fair searches, and to have a trial by jury. These were all rights that the British government had ignored before the Revolution. Federalists claimed that those rights were protected even though they were not specifically listed. After more than two years of discussions, James Madison proposed amendments, or additions, to the Constitution that would protect a citizens rights.The House of Representatives passed seventeen amendments on August 24, and the Senate consolidated them into twelve amendments. The Senate passed them on September 9. In order for the amendments to become law, however, the states also had to approve them. Congress sent the amendments to the states on September 25. The states approved ten of the twelve amendmentsknown as the Bill of Rightson December 15, 1791. The United States had a new government plan that allowed it to become not only the most powerful nation in the world but also the greatest protector of human rights. Select two sentences which demonstrate that it was difficult to get states to ratify the Constitution.Question 1 options:"Because of their experiences with the British government, the colonists had limited the power of the United States central government under the Articles.""After more than two years of discussions, James Madison proposed amendments, or additions, to the Constitution that would protect a citizen's rights.""It soon became clear that some statesespecially big states such as Massachusetts, New York, and Virginiawere not ready to adopt the Constitution.""Respected people, or delegates, from all the colonies except for Rhode Island met in Philadelphia in 1787 to create a new constitution.""The list included the right to speak freely, to worship freely, to have fair searches, and to have a trial by jury." GIVING BRAINLIEST PLS FAST Light of 650 nm wavelength illuminates two slits that are 0.20 mm apart. (Figure 1) shows the intensity pattern seen on a screen behind the slits.What is the distance to the screen?PLEAsE URGENT. thank you Without graphing, classify the system as independent, dependent, or inconsistent.S x 5 = - y| 2y - 10 = 21 Justin worked 12 hours and 4 minutes on Saturday and 13 hours and 41 minutes on Sunday. How many hours did Justin work this weekend? an evolutionary psychologist would explainthat humans desire social interaction, social acceptance, and social affiliation due to a need for A curator is a person that _____.A) creates artwork for an exhibitionB) visits an art exhibitionC) critiques artwork in an exhibitionD) organizes and creates an exhibition aamWhy did places like "Chinatownand Little Italy emerge in bigcities like New York City?A. The federal government allowed for sovereignterritories.B. Most states set up reservations like those forNative Americans.C. Immigrants from a given country chose to liveclose together.D. Employers required immigrants to live neartheir countrymen.Copyright 2003 - 2021 Acellus Corneration What describes the geosphere help???? i will be so greatfull