Which statement is best represented by the diagram?
All carbon is in the form of carbon dioxide,
Carbon can exist in many forms, but the total amount of carbon stays the same.
The amount of carbon in the cycle can increase or decrease based on the number of factories present.
Only living things release carbon dioxide into the atmosphere.
Answers
Answer:
All carbon is in the form of carbon dioxide
Related Questions
In your lab group, you are investigating the properties of unknown types of matter. Your teacher gives you a "detective's kit
consisting of: vinegar (an acid), pH strips, and water. She asks you to design experiments to determine the chemical properties of the
unknowns. Select ALL of the experiments you might perform to observe chemical properties.
A)
measuring the pH
B)
measuring the mass
C)
measuring the density
D)
measuring the boiling point
E)
checking for reactivity with vinegar
Answers
Answer:
A: measuring the pH
E:checking for reactivity with vinegar
Explanation: I don't have one
The chemical property of the unknown substance can be measured by checking for reactivity with vinegar.
The chemical properties of a substance are those properties of a substance that we can observe by allowing the substance to be changed via a chemical reaction. In other words, chemical properties are observed by passing the substance through a chemical reaction.
Hence, the experiment that you will need to perform in order to determine the chemical properties of the unknown substance is checking for reactivity with vinegar.
Learn more: https://brainly.com/question/25105283
3.4.3 Lab: Why are cells so small?
Answers
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
3. A house has several systems, such as the electrical system, plumbing system, and
heating and cooling system. In what ways are the systems of a house similar to
human body systems?
Answers
I hope this could help you! ^^
How do the hormones of the endocrine system act as a feedback mechanism for the menstrual cycle?
Answers
In positive feedback, rising levels of hormones feedback to increase hormone production. During most of the menstrual cycle, estrogen and progesterone provide negative feedback to the hypothalamus and pituitary gland. This keeps their levels more or less constant.
In negative feedback, rising levels of hormones feedback to the hypothalamus and pituitary gland to decrease the production of the hormones. In positive feedback, rising levels of hormones feedback to increase hormone production. During most of the menstrual cycle, estrogen and progesterone provide negative feedback to the hypothalamus and pituitary gland. This keeps their levels more or less constant. During days 12–14, however, estrogen provides positive feedback to the hypothalamus and pituitary gland. This causes a rapid rise in the production of estrogen by the ovaries and leads to ovulation.
Allopatric speciation is most likely to occur when a ______ population is separated from the ______ population.
HELP PLEASEEE
Answers
What is the primary cause of deforestation?
Select one:
a. Conversion of land for crops and pasture land
b. Harvesting for fuel wood
c. Paper industry pressures
Answers
Answer: B
Explanation: Googl/What is the primary cause of deforestation?
Daphne identifies the entire sequence of nucleotides in a gene. Based on this information and the genetic code, she predicts the sequence of amino acids in the protein that the gene codes for. What is the MOST LIKELY reason that Daphne’s prediction would be incorrect?
The gene codes for a carbohydrate, and not a protein.
A mutation changes the genetic code that the cell uses.
The cell removes introns from pre-mRNA.
The cell removes introns from DNA.
Answers
Answer:
The cell removes introns from pre-MRNA
Explanation:
6. How can an introduced species affect an ecosystem?
Answers
Answer:
When a new and aggressive species is introduced into an ecosystem, it may not have any natural predators or controls. It can breed and spread quickly, taking over an area. Invasive species can change the food web in an ecosystem by destroying or replacing native food sources.
Explanation:
I majored in Biology
The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there to
A)
move liquid.
B)
catch debris.
C)
secrete mucus.
D)
transmit impulses
Answers
Answer:
B. catch debris in the lungs
Only answer if you know the answer
Answers
Answer:
B. A helicase enzyme unwinds the DNA molecule, then corresponding nucleotides are added to the separated original strand forming two separate semiconservative molecules
Explanation:
DNA Replication is an important phenomenon as far as cell division is concerned. It is the process whereby a DNA molecule doubles its content or forms two DNA molecules from one.
In the semi-conservative model of DNA replication, an enzyme called DNA helicase unwinds the double stranded DNA molecule into two single strands. The single strands are then used as template for DNA polymerase to synthesize another molecule of DNA. Hence, two separate DNA molecules comprising of one old strand and one new strand.
Phototropism -
Definition:
Sentence:
Picture:
Can someone please help me?!
Answers
Answer:
Phototropism is the type of tropism where an organism responds to light as the stimulus.
Forexample, a plant enclosed in a box with a small hole and placed in light, the tip of the plant will grow towards the hole
Hemophilia is a recessive sex-linked trait. A non-hemophiliac man and woman marry and
have a daughter who is a hemophiliac. The father of this child suspects infidelity and is
considering a divorce. Does he have sufficient evidence of infidelity? Explain.
Answers
The father does not have sufficient evidence of infidelity as the parent's genotype is not mentioned which could have the recessive trait of hemophilia being inherited to the daughter.
What is hemophilia?Hemophilia is a disorder which is rare which results when the blood does not clot in it's usual way as it does not have sufficient blood-clotting factors .A person suffering from hemophilia can bleed for a longer period of time resulting in blood loss.
It is almost always that hemophilia occurs genetically . Treatment of hemophilia include replacement of the specific blood clotting factor that is reduced. Symptoms of hemophilia vary from person to person depending on the level of the clotting factors.
Signs and symptoms include excessive bleeding ,large or deep bruises, pain or swelling in joints ,nosebleeds,etc.
Learn more about hemophilia,here:
https://brainly.com/question/1428363
#SPJ2
what is anaerobic respiration
Answers
Answer:
Anaerobic respiration is the type of respiration through which cells can breakdown sugars to generate energy in the absence of oxygen.
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answers
Answer: The answer is B
Explanation:
Need help will mark Brainliest
Answers
Answer: the secondary response to Antigen A is greater because the lymphocytes remember the antigen
What are the two products made during the electron transport chain?
Answers
Answer:
Water and ATP
Explanation:
Answer:
H20 and ATP
Explanation:
Hope this helps :)
Word Bank: Slowly, Within, Different, Transmitted, Densely, Sonar, Solids, Absorption, Bounces
Mechanical waves react to different mediums in different ways. Some mechanical waves are _________________ through a medium, meaning they pass through the medium. The way in which waves are transmitted depends upon the type of material. In ________________, mechanical waves travel rapidly, because the molecules are ___________________ packed. In liquids and air, however, mechanical waves travel more _________________, because the molecules are spread farther apart.Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it ______________ off the medium and then travels in a ______________ direction. ______________ is an application that uses sound wave reflection to determine how deep water is. A third way mechanical waves react to a medium is _______________. When a mechanical wave is absorbed, it remains __________________ a medium and is not transmitted to another medium.
Answers
Answer:
Mechanical waves react to different mediums in different ways. Some mechanical waves are TRANSMITTED through a medium, meaning they pass through the medium.
The way in which waves are transmitted depends upon the type of material. In SOLIDS, mechanical waves travel rapidly, because the molecules are DENSELY packed. In liquids and air, however, mechanical waves travel more SLOWLY, because the molecules are spread farther apart.
Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION. When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
The fill in the blanks will be filled with TRANSMITTED, SOLIDS, DENSELY, SLOWLY, BOUNCES, DIFFERENT, SONAR, ABSORPTION, WITHIN
Mechanical waves:react to distinct mediums in various ways. Some mechanical waves are TRANSMITTED via a medium, meaning they pass via the medium. The way in which waves are transmitted based upon the type of material. In SOLIDS, mechanical waves travel rapidly, due to the molecules are DENSELY packed.
In liquids and air, however, mechanical waves travel more SLOWLY, due to the molecules being spread farther apart.Other mechanical waves are reflected off a medium.
When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION.When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
Learn more about the waves here: https://brainly.com/question/3102539
please helpp if you dont know the answer that's ok but please helpp
Answers
which of the following are part of the central nervous system?
Answers
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
jake tested the effect of purple light on the growth of eggplants
Find the independent & dependent variables.
Answers
Answer:
Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3. Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3.
Explanation:
Answer:
Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3. Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3.
Explanation:
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answers
Answer:
hi love you have a nice day
Explanation:
Humans always have a negative impact on the environment.
Please select the best answer from the choices provided
T
F
Answers
What is the importance of Mitosis in both Prokaryotic and Eukaryotic Cells
Answers
Answer:
Mitosis is the process by which the overwhelming number of cell divisions in eukaryotic organisms occur. Eukaryotes (animals, plants and fungi) typically consist of literally trillions of cells, and at any time, countless worn-out, dead or irreparably damaged body cells need to be replaces. Mitosis is the eukaryotic answer to binary fission in the single-celled prokaryotes, which is similar on the surface but simpler at the level of details.
Explanation:
3. How does changing the number of neutrons affect an atom?
Answers
Answer:
The change of number of neutrons does not affect the charge of the atom. All it will affect is your average atomic mass which is the sum of protons and neutrons.
Explanation: Hope this can help! ^^
Answer:
It will change the isotopes.
Apply: Which type of moth do you think was more common before the 19th century, when most trees were light in color?
Answers
Answer:
light moths
Explanation:
yes their were most light color in most trees
Light moths was more common before the 19th century, when most trees were light in color.
What are the functions of light moths?Insects, like moths, are drawn to bright lights because they make it difficult for them to navigate. It's a common sight, particularly in the summer: The lights, like lamps, were surrounded by moths and other insects.
Most nocturnally dynamic moths are drawn to light, a peculiarity known as sure phototaxis. However, because they are phototactic, some species, like the Old Lady (Mormo maura), tend to avoid it.
No one really knows why moths are drawn to light, but there are a few theories, and they also like the smell of fermented sugar and ripe fruit, which are both food sources.
Learn more about light moths:
https://brainly.com/question/14452844
#SPJ3
1. What is an operon?
a. The binding site for a repressor PRO.
b. Any group of genes responsible for the metabolism of lactose in a prokaryotes or eukaryotes.
c. A cluster of genes under the control of a promoter.
d. A regulatory gene.
Answers
Answer:
The answer is D
Explanation:
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answers
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
Why is the nucleus called the "control center" of the cell?
Answers
when a carbohydrate chain is attached to a protein what is the structure called
Answers
Glycoproteins are proteins which contain oligosaccharide chains (glycans) covalently attached to amino acid side-chains. The carbohydrate is attached to the protein in a cotranslational or posttranslational modification. This process is known as glycosylation. Secreted extracellular proteins are often glycosylated.
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answers
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.