Which of these is another name for Newton's
first law?
A. the law of action-reaction
B. the law of force and acceleration
C. the law of gravity
D. the law of inertia

Answers

Answer 1
Newton's first law states that every object will remain at rest or in uniform motion in a straight line unless compelled to change its state by the action of an external force.
Answer 2
D. The law of inertia

Related Questions

(BRAINLIEST)
Which is an example of the force of attraction between two objects that have mass?

Magnetism
Gravity
Solar energy
Electricity
(BRAINLIEST)

Answers

Answer:

Gravity

because it's factorised by mass of a body.

For other forces, they deal with charges of negligible mass and weights

Answer:

Gravity

Explanation:

a 45 kg boy sits on a horse on a carousel 5.0 m from the center of the circle. he makes a revolution every 8.0 s.
calculate his speed.
what is centripetal force acting on the boy?​

Answers

Answer:

2.9m/s and 140N

Explanation:

For speed convert rev/s to m/s

(Rev/8s)=(2π/8)(5m) = 3.9m/s

For Centripetal Force

Fc = (ac)(m) = (v^2/r)(m) = [(3.9m/s)^2/(5.0m)][45kg] = 140N

Answers go to two significant figures.

how are hydrosphere, atmosphere, Biosphere, and Biosphere connected to one another

Answers

Explanation:

Such spheres are intimately connected. Many animals (biosphere), for example, migrate through to the sky, while groundwater (hydrosphere) also flows through the ground (lithosphere). The domains are actually so closely related that a shift in one globe always results in a shift in one or both of some other spheres.

Optimus Prime is flying straight up at 24 m/s when he accidentally drops his mega-ray blaster and it falls 94 m to the ground below. Calculate how long it takes for his mega-ray blaster to hit the ground.

Answers

Answer:

The time it will take the mega-ray blaster to hit the ground is 2.57 s.

Explanation:

Given;

initial velocity of Optimus Prime, u = 24 m/s

height of fall of the mega-ray blaster, h = 94 m

The time of fall of the mega-ray blaster is calculated using the following kinematic equation;

[tex]h = ut + \frac{1}{2}gt^2\\\\94 = 24t + \frac{1}{2}(9.8)t^2\\\\94 = 24t + 4.9t^2\\\\4.9t^2 +24t -94 = 0\\\\Use \ formula \ method \ to \ solve \ for \ "t"\\\\a = 4.9 , b = 24, c = -94\\\\t = \frac{-b \ +/- \ \sqrt{b^2 -4ac} }{2a} \\\\t = \frac{-24 \ +/- \ \sqrt{(24)^2 -4(-94 \times4.9)} }{2(4.9)} \\\\t = \frac{-24 \ +/- \ \sqrt{2418.4} }{9.8}\\\\t = \frac{-24 \ +/- \ 49.177 }{9.8}\\\\t = \frac{-24 \ +\ 49.177 }{9.8} \ \ or \ \ t = \frac{-24 \ -\ 49.177 }{9.8} \\\\[/tex]

[tex]t = 2.57 \ s \ \ or \ \ t = -7.47 \ s[/tex]

t = 2.57 s

Therefore, the time it will take the mega-ray blaster to hit the ground is 2.57 s.

let's say you hypothetically ran over someone with your car, and they are now under your car in between the front wheels and the back wheels, right, and they're stuck as in can't breathe type stuck, right, do you keep driving so they can breathe or do you let them chill under your car?
just curious...​

Answers

question: is this actually hypothetical?

Explanation:

also just leave the car there go get some McDonald's or sum and come back and if they're still breathing then go ahead and move the car .

Answer:

the same thing the last guy said

Delaney loves her new kiddie pool, but she is afraid to get wet. She crawls around the outside of the pool for hours. Jocelyn says Delaney is making rotations around the pool and Jonathan says Delaney is making revolutions around the pool. Who is correct? Suppose your answer with evidence.

Answers

Answer:

Revolutions

Explanation:

what is happening in terms of matter and energy, while wood burns?

Answers

Answer:

The law of conservation of mass states that matter cannot be created or destroyed in a chemical reaction. For example, when wood burns, the mass of the soot, ashes, and gases, equals the original mass of the charcoal and the oxygen when it first reacted. So the mass of the product equals the mass of the reactant

9 The friction between the car and the mud is equivalent to the__________________.

(a) Resultant force
(b) Drag force
(c) Equivalent force
(d) Stretch force
(e) None

Answers

Answer: e. None

Explanation: when the car goes into the muddy area, then the friction force on the tire is too small so the wheels are turned and slipped. Friction in this case is beneficial

List two examples of how the land can have a dramatic change in temperature throughout the day.

Answers

Answer:

one could freeze and the second would thaw

Explanation:

sorry if its wrong

The two examples of how land can have a dramatic change in temperature

is during freezing and thawing.

Cold temperatures which is common during the winter period is

characterized by the formation of snow and freezing of smaller water

bodies.

There may be a short phase in which there is relative sunlight which melts

the frozen substances thereby forming liquids . This is usually as result of

the temperature being on the increase in the atmosphere.

Read more on https://brainly.com/question/25671319

A bicycle has a momentum of 36 kg•m/s and a velocity of 4 m/s. What is the mass of the bicycle?

Answers

Answer:

45kw45_32+675&453try to get it done

Answer:

A: 9 kg

Explanation:

on edge! hope this helps!!~ ∩(︶▽︶)∩

A 1.5kg object moving with a speed of 2.5m/s strikes a wall and the ball rebounds with a speed of 1.5m/s. The ball is in contact with the wall for 0.045s. What is the magnitude of the average force exerted on the ball by the wall?

Answers

Answer:

F = 133.33[N]

Explanation:

This problem can be solved by the principle of momentum conservation, which tells us that momentum is preserved before and after the bounce of the ball on the wall.

In such a way that the movement towards the wall we will take it with a positive sign, and the force of the rebound to the left as negative. The movement to the left will be taken as a negative sign.

[tex]m_{1}*v_{1}-F*t=-m_{1}*v_{2}[/tex]

where:

m₁ = mass of the object = 1.5 [kg]

v₁ = velocity of the ball before hitting the wall = 2.5 [m/s]

F = average force [N]

t = time contact = 0.045 [s]

v₂ = velocity of the ball after hitting the wall = 1.5 [m/s]

Now replacing:

[tex](1.5*2.5)-F*0.045=-(1.5*1.5)\\3.75+2.25=F*0.045\\F=6/0.045\\F=133.33[N][/tex]

How far will a 10N force pull a car if the work done is 20J?

Answers

Since Work done= Force x distance/displacement. Therefore substituting the values in and making Distance the subject of formula we get d=W/F =20/10 = 2 meters

a ball of diameter 10 cm and mass 10 grams is dropped in a container of water. the cross sectional area of the container is 100 cm2.. what is the change in the height of the water column

Answers

Answer:

h = 9.83 cm

Explanation:

Let's analyze this interesting exercise a bit, let's start by comparing the density of the ball with that of water

       

let's reduce the magnitudes to the SI system

         r = 10 cm = 0.10 m

         m = 10 g = 0.010 kg

         A = 100 cm² = 0.01 m²

the definition of density is

          ρ = m / V

the volume of a sphere

         V = [tex]\frac{4}{3} \ \pi r^{3}[/tex]

          V = [tex]\frac{4}{3}[/tex] π 0.1³

          V = 4.189 10⁻³ m³

let's calculate the density of the ball

           ρ = [tex]\frac{0.010}{4.189 \ 10^{-3} }[/tex]

           ρ = 2.387 kg / m³

the tabulated density of water is

         ρ_water = 997 kg / m³

we can see that the density of the body is less than the density of water. Consequently the body floats in the water, therefore the water level that rises corresponds to the submerged part of the body. Let's write the equilibrium equation

            B - W = 0

            B = W

             

where B is the thrust that is given by Archimedes' principle

           ρ_liquid  g V_submerged = m g

           V_submerged = m / ρ_liquid

we calculate

            V _submerged = 0.10 9.8 / 997

             V_submerged = 9.83 10⁻⁴ m³

The volume increassed of the water container

           V = A h

            h = V / A

let's calculate

            h = 9.83 10⁻⁴ / 0.01

            h = 0.0983  m

this is equal to h = 9.83 cm

A particular inductor is connected to a circuit where it experiences a change in current of 0.8 amps every 0.10 sec. If the inductor has a self-inductance of 2.0 V, what is the inductance

Answers

Answer:

0.4

Explanation:

Given that a particular inductor is connected to a circuit where it experiences a change in current of 0.8 amps every 0.10 sec. If the inductor has a self-inductance of 2.0 V, what is the inductance

Using the power formula

P = IV

Substitute all the parameters

P = 0.8 × 2

P = 1.6 W

But P = I^2 R

Substitute power and current

1.6 = 0.8^2 R

R = 1.6 / 0.64

R = 2.5 ohms

Inductance = reciprocal of resistance

Inductance = 1 / 2.5

Inductance = 0.4

A water molecule has 2 hydrogen atoms and 1 oxygen atom. If you were to add an additional oxygen atom to the molecule, would it still be water? If not, what would it be?

Answers

Answer:

No, it would not still be water. it would be hydrogen peroxide

Explanation:

water is [tex]H_{2} O[/tex]. Adding another oxygen would make it [tex]H_{2} O_{2}[/tex], which is hydrogen peroxide

Answer:

It would be Hydrogen peroxide

Explanation:

Atoms actually prefer being configured as water (H2O). Adding on the extra oxygen takes a lot of energy (and other chemicals). That's why we see lots of water and not much hydrogen peroxide around in nature. The reason hydrogen peroxide (H2O2) is dangerous is because it actually wants to drop off that extra oxygen and become water. Anything that does this is called an oxidising agent. An oxygen atom on it's own is pretty unstable and really wants to snatch up electrons from somewhere. First it'll probably gobble up some free floating hydrogen and make some more water with it. In our bodies we don't have much free floating hydrogen, so it runs out pretty quick. The oxygen atom army then has to start breaking up bigger molecules to steal the hydrogens and sometimes even the nitrogens. This breaks up the molecules that form the structures of your body and leaves you with a jumble of random configurations of atoms where the oxygen atoms passed through. Now, before you ask, normally oxygen doesn't do it to you because it exists in the air as O2, bonded to itself. The isolated oxygen atoms only exist for a brief time after they've split up from the hydrogen peroxide.

True or False: A cheetah, that has a mass of 40 kg, must exert a bigger force to change directions than a 15 kg gazelle because the cheetah has a greater mass

Answers

True my friend hope this helps

Water is found as a solid, liquid, and gas on ____.

Answers

If this question is about planets, Earth is your answer

Q3) Salman walks to the mosque with speed 2.4 m/s. If it takes him 3 min to
reach the mosque. Find the distance.​

Answers

Answer: 432m

Explanation:

Convert 3 min to seconds

1 min = 60 sec

3 min = 180 sec

Multiply the speed times time to get distance.

2.4 x 180 = 432m

A rectangular block weighs 240 N. the area of the block in contact with the floor is 20 cm2.calculate the pressure on the floor(give your answer in N/cm2
Help me Fast as you can,,

Answers

Answer:

12 N/cm²

Explanation:

From the question given above, the following data were obtained:

Weight (W) of block = 240 N

Area (A) = 20 cm²

Pressure (P) =?

Next, we shall determine the force exerted by the block. This can be obtained as follow:

Weight (W) of block = 240 N

Force (F) =.?

Weight and force has the same unit of measurement. Thus, we force applied is equivalent to the weight of the block. Thus,

Force (F) = Weight (W) of block = 240 N

Force (F) = 240 N

Finally, we shall determine the pressure on the floor as follow:

Force (F) = 240 N

Area (A) = 20 cm²

Pressure (P) =?

P = F/A

P = 240 / 20

P = 12 N/cm²

Therefore, the pressure on the floor is 12 N/cm².

If you want to delay a pulse of light in a laser experiment, you can send the light through a long coil of fiber optic cable. Light travels somewhat slower in the glass core of a fiber than it does in vacuum. We will approximate the speed of light in the fiber as 2.04 x 108 m/s. What length of fiber (in meters) should you use if you want to delay the arrival of light by 557 ns

Answers

Answer:

d = 113.6 m

Explanation:

For this exercise, the first thing we must notice is that the speed of the laser beam in the fiber is constant, so we can use the uniform motion relationships to find the necessary distance

          v = d / t

let's reduce to SI units

         t = 557 ns = 557 10⁻⁹ s

         d = v t

         d = 2.04 10⁸ 557 10⁻⁹

         d = 1.136 102 m

         d = 113.6 m

This is the distance of the fiber for the laser to arrive with the desired delay

Select the correct answer.
Which of these factors will increase the speed of a sound wave in the air?
A. slowing down the movement of particles in the air
B. raising the temperature of the air
C. removing particles form the air
D. decreasing the kinetic energy of the air
E. stopping particle collisions in the air

Answers

Answer:

B

Explanation:

But molecules at a higher temperature have more energy.

Answer: B. Raising the temperature of the air

Two identical plastic cups contain the same amount of water at two different temperatures, as shown to the left. Both cups are placed in a room at 25° Celsius. At the time cups were placed in the room, in which cup do the water molecules have higher average kinetic energy? ( Cup 1 © Cup 2​

Answers

Answer:

the molecules will begin to move slowly and will turn to ice

Explanation:

hope this was good or not not sure if am right but yeah

which is true about the way air flows

A. high pressure to low pressure

B. low pressure to high pressure

C. cold air to hot air

D. hot air to cold air

Answers

Answer:

A High-to-Low

Explanation:

its like water running down a hill.

There are 25 elements found in living things. How many of these elements are found in some organisms but not all?

1
6
19
25

Answers

Answer: 6

Explanation:

Of those 25 elements found in living things, 6 of them can be found in all of them. These 6 are very integral to life as when they combine, they make up cells, tissues and other body components.

These elements are: Carbon, Oxygen, Nitrogen, Hydrogen, Phosphorus and Sulfur. Their combinations can either create organic or inorganic compounds.

Answer:

19

Explanation:

i got 19... not sure if 6 is correct

How much power is used if a force of 35n is used to push a box a distance of 10 meters in 5 seconds ?

Answers

Answer:

pratyush the first boy984

Three displacements are A = 200 m due south, B %3D 0 m due west, and C = 150 m at 30.0° cast of north. %3D Construct a separate diagram for each of the following possible ways of adding these vectors: R = A +B - č, Explain what R = B + C + A; R =C + B + A %3D you can conclude from comparing the diagrams.

Answers

Answer:

a) The diagrams can be seen in the picture attached

(b) By comparing the diagrams we can conclude that the resultant R₁ = R₂ = R₃

Further explanation

Vector is quantity that has magnitude and direction.

One example of a vector is acceleration.

Acceleration is rate of change of velocity.

a = acceleration ( m/s² )

v = final velocity ( m/s )

u = initial velocity ( m/s )

t = time taken ( s )

d = distance ( m )

Let us now tackle the problem !

This problem is about Vector and Vector Diagram.

Given:

Vector A = -200 j

Vector B = -250 i

Vector C = (150 sin 30.0°) i + (150 cos 30.0°) j = 75 i + 75√3 j

Unknown:

R₁ = A + B + C = ?

R₂ = B + C + A = ?

R₃ = C + B + A = ?

Solution:

R₁ = A + B + C  = (-200 j) + (-250 i) + (75 i + 75√3 j)

R₁ = -175i + (75√3 - 200)j

R₂ = B + C + A = (-250 i) + (75 i + 75√3 j) + (-200 j)

R₂ = -175i + (75√3 - 200)j

R₃ = C + B + A  = (75 i + 75√3 j) + (-250 i) + (-200 j)

R₃ = -175i + (75√3 - 200)j

From the results above, it can be concluded that the resultants above produce the same results. This can be confirmed from the diagrams in the attachment.

Explanation:

Suppose that when spring was wound, 100J of work was done but 15J escaped to the surrounding as heat. The change in internal energy of the spring is? ​

Answers

Answer: 85J

Explanation:

From the question, we are informed that when spring was wound, 100J of work was done but 15J escaped to the surrounding as heat.

Therefore, the change in internal energy of the spring will be calculated as:

ΔU = q + w

where, q = -15J

w = 100J

ΔU = -15J + 100J

= 85J

A 420 g soccer ball is kicked into the air with an initial velocity of 30 m/s. How much kinetic energy does the soccer ball have?

Answers

Answer:189000J

Explanation:KE=1/2mv^2

1/2(420g)(30m/s)^2

=189000J

Help!! Help!!

Alcohol __ a person's respiration.
A. slows down
B. Increases
C. doesn't affect

Answers

Answer:

I think the answer is A. Slow down

Explanation:

I agree the answer should be (A) slows down

What is the relationship between force and momentum?

A. A force will always increase momentum
B. A force acting for a certain time results in a change in momentum
C. There is no relationship
D. It depends on the kind of force​

Answers

Answer:

Explanation:

B

Other Questions
BackgroundLayout-ThemeTestos2Freda bought 6 gallons of gasoline for $19.14What was the unit price of this gasoline? Read the quotation below from a high school science student.We used a formal method of study to figure out which kindof grocery bag had the least effect on the environment.What is the student describing?O A. Using scientific toolsB. Making random discoveriesC. Using the scientific methodD. Making a conclusion 3(5 + 6)=....................... A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning.