Which of the following is NOT ​

 Which Of The Following Is NOT

Answers

Answer 1

Answer:

Psychrometer

Explanation:


Related Questions

Are Bacteria (essential/non-essential) to sustaining the EcoSphere?

Answers

Essential because not all bacteria are harmful and we need bacteria in our daily lives

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

100 Points and Braniliest! Pls help asap. I will name u brainliest! Pls help asap. I will name u brainliest! Pls help asap. I will name u brainliest! Pls help asap. I will name u brainliest! Pls help asap. I will name u brainliest! Pls help asap. I will name u brainiest! Pls help asap. I will name u brainliest!Pls help asap. I will name u brainliest! Pls help asap. I will name u brainliest!
Can u spot the difference in the sentences above?
Actual questions:

Answers

Answer:

they are too tiny, can't read them

Answer:

you need to make it bigger pls make another one

Explanation:

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?

Answers

Answer:

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of  the process of cellular respiration. And what happens to the other 66% is that it's  used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat

Explanation:

What components are needed for
photosynthesis?

Answers

Answer:

sunlight, carbon dioxide, and water as substrates

Explanation:

Hope this helps :]

Answer:

Explanation:

chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.

what is homeostasis?

the body's way of coping of outside factors

the body's ability to heat up and cool down

the body's natural way of maintaining equilibrium or balance

the body's standard heart rate​

Answers

The body’s natural way of maintaining equilibrium or balance

Answer: C or if there is an E for all the above

Explanation: Homeostasis refers to the body’s ability to maintain a stable internal environment (regulating hormones, body temp., water balance, etc.).

Please help me
Which particle, protons, neutrons, or electrons, has the LEAST mass?

Answers

Answer:

Electrons are much smaller in mass

Explanation:

Although similar in mass, protons are positively charged, while neutrons have no charge. Therefore, the number of neutrons in an atom contributes significantly to its mass, but not to its charge. Electrons are much smaller in mass than protons, weighing only 9.11 × 10−28 grams, or about 1/1800 of an atomic mass unit.

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

What is H₂O - H₂+ boz

Answers

Answer:

-tH2

H20 - H2 + boz

0-H2t

-tH2

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.

Answers

Answer:

A handler must know an animal’s pattern of movement in order to avoid injury.

Explanation:

Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.

Answer:

A

Explanation:

i got it wrong and it showed the correct answer

A water molecule is attracted to another water molecule. This is an example of

Answers

This is an example of cohesion. :)

Different plant species require different amounts of direct sunlight in order to flower. A student designed an experiment to determine the length of exposure to direct sunlight necessary for a specific plant species to produce flowers. The student collected the data below.


0 hours, 0% with flowers


9 hours, 0% with flowers


1 hour, 0% with flowers


5 hours, 90% with flowers


3 hours, 80% with flowers


7 hours, 10% with flowers


Identify the:

independent variable-

dependent variable-

control group-

experimental group-

constant-

Answers

Answer:

Independent variable: LENGTH OF EXPOSURE TO DIRECT SUNLIGHT

Dependent variable: PRODUCTION OF FLOWERS

Control group: THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours

Experimental group: THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT

Constant: THE SAME PLANT SPECIES

Explanation:

Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the experimenter exposes the specific plant species to sunlight at different length of time, hence, the LENGTH OF EXPOSURE TO DIRECT SUNLIGHT is the independent variable.

Dependent variable is the variable which is measured in an experiment. In this experiment, the measured/dependent variable is the PRODUCTION RATE OF FLOWERS by the plant species.

Control group is the group in an experiment that does not receive the variable being tested. In this experience, the control group is THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours

Experimental group is the group of am experiment that is exposed to the experimental treatment (sunlight). In this case, the experimental group is THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT.

Constants are variables of an experiment that must be kept unchanged for all groups throughout the experiment in order not to affect the experiment's outcome. In this experiment, the constant is THE SAME PLANT SPECIES used,

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

List some common adaptations in organisms

Answers

Some common adaptation in organisms would be:

Behavioral adaptation.
Biological adaptation.
Natural selection.

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

2. Chemicals that absorb light
are called

Answers

Answer:

Chemicals that absorb light are called Pigments. 3. Chlorophyll makes plants look green because it Reflects green light.

Explanation:

Answer:

pigments

Explanation: Chlorophyll makes plants look green because it Reflects green light.

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

Help please
I’m begging you, due in an hour

Answers

Answer:

1 should be D and 2 should be A

Give two examples of why water is important to the human body.

Answers

Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

Which is the process by which gas exchange between the respiratory system and the blood cells in the cappilaries occurs? transfusion condensation evaporation diffusion

Answers

Answer:

Diffusion

Explanation:

Diffusion is the process by which molecules of substances move from regions of higher concentration to regions of lower concentration until equilibrium concentration is attained. This movement of molecules is because a concentration gradient exists between the two regions.

Blood cells in the capillaries is low in oxygen because the cells have used up the oxygen in cellular respiration. However, in the lungs, the oxygen concentration is high due to inspiration of oxygen from the external environment. Therefore, a concentration gradient exists between the lungs and blood cells in the capillaries. Oxygen from the lungs diffuses into the blood cells in the capillaries, and these blood cells are then returned to other parts of the body by the circulatory system. This is a continuous process and is known as gaseous exchange.

Answer:

Diffusion

Explanation:

Please hurry
1. Identify one environmental factor that could cause a base sequence in DNA to be changed to a different base sequence.

2. Explain why, in a mammal, a mutation in a gamete may contribute to change in the population of the organism while a mutation a body cell will not.

Answers

Answer:

Explanation:

1     Long term exposure to harmful genotoxic chemicals or ionizing radiation can cause changes in the base sequence of DNA.Chemicals might induce DNA mutations, such as polycyclic hydrocarbons (fumes found in oil stations, or smoke from a tobacco cigarette), intercalating agents such as Ethidium Bromide (carcinogen), but also radiations such as UV-radiation (C and T bases are most vulnerable and would bind to identical bases unstead of their

2    Genetic changes that are described as de novo (new) mutations can be either hereditary or somatic. In some cases, the mutation occurs in a person’s egg or sperm cell but is not present in any of the person’s other cells. In other cases, the mutation occurs in the fertilized egg shortly after the egg and sperm cells unite. (It is often impossible to tell exactly when a de novo mutation happened.) As the fertilized egg divides, each resulting cell in the growing embryo will have the mutation. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell in the body but the parents do not, and there is no family history of the disorder.

Somatic mutations that happen in a single cell early in embryonic development can lead to a situation called mosaicism. These genetic changes are not present in a parent’s egg or sperm cells, or in the fertilized egg, but happen a bit later when the embryo includes several cells. As all the cells divide during growth and development, cells that arise from the cell with the altered gene will have the mutation, while other cells will not. Depending on the mutation and how many cells are affected, mosaicism may or may not cause health problems.

I WILL MARK BRAINLIEST
Part B: Evaluating Results

Question 1
Explain why your model demonstrates how crossing over is important to genetic variation in a species

Answers

Answer:

Crossing over is essential for the normal segregation of chromosomes during meiosis. Crossing over also accounts for genetic variation, because due to the swapping of genetic material during crossing over, the chromatids held together by the centromere are no longer identical.

Explanation:

what is empty space that is free of matter

Answers

Outer space is an empty space that’s made up of gases, electromagnetic radiation, magnetic fields, neutrons and dust

When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)

Answers

Answer:

Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.

Explanation:

So its A

Other Questions
Read the excerpt from Esperanza Rising.Burning with humiliation, Esperanza dropped the broom and ran back to the cabin.In her room, she sat on the edge of the cotHer face flushed again at the thought of the ridicule. She was still sitting there, staring at the wall, when Isabel found her."I said I could work. I told Mama I could help. But I cannot even wash clothes or sweep a floor. Does the whole camp know?"Isabel sat down on the bed next to her and patted her back. "Yes."Esperanza groaned. "I will never be able to show my face." She put her head in her hands until she heard someone else come into the room.Which words does the author use to show that Esperanza is ashamed?she heard someone elseburning with humiliationI told Mama I could helpstaring at the wall How did American soldiers react to the liberation of concentration camps? pls help quick. the number line shows the starting and ending velocities for ball 1 what's the change in velocity of ball 1 calculate the value mathematically and check using the number line The movement of air caused by differences in air pressure is __________________. Evaluate and simplify the expressionwhen x= 3 and y = 5.2y + 3(x - y) + x2 = [ ? ] What was Thomas Paine's opinion about the colonies and Great Britain?O A The colonies should break from British rulle.O B. The colonies should continue to be taxed by BritainO C. The colonies should remain under Brish rulle.O D. The colonies should stop fighting the British A cook has 11.64 pints of olive oil before the dinner service. There were 5.2 pints of olive oil used during the dinner service. What amount of olive oil is left after the dinner service, with the correct number of significant digits?A. 6.44 pintsB. 16.84 pints C. 6.4 pintsD. 17 pints Phones collected from a conferences are labeled 1 through 40. What is the probability that the conference speaker will choose a number that is not a multiple of 6?Give your answer as a fraction. What are the advantages of using resources such as geothermal energy, solar energy, and hydropower?They produce large amounts of energy from burning fuels.They can generate power by burning wastes.They come from energy sources that never run out. They increase the amount of greenhouse gasses. Write a 300-500 word essay that examines the role one historical figure in American society. Discuss how that personexemplified at least three characteristics of great leadership or heroism. Be sure to clarify the definitions of yourqualifications in your essay. Include a works-cited page for your essay, and ensure that you edit your work for objectiveword choice, clear specific details, and meaningful transitions to connect the ideas of the essay, factory has supplies expenses of $1135.78 a day, in addition to the wages above and makes $60,128.72 in one week, what is the factory's total profit or loss in one week? Using complete sentences, explain how the progressive movement influenced labor laws and rights. Make sure to include provisions set by the progressive movement for workers. Point \blue{A}Astart color #6495ed, A, end color #6495ed is at \blue{(-2, -7)}(2,7)start color #6495ed, left parenthesis, minus, 2, comma, minus, 7, right parenthesis, end color #6495ed and point \purple{M}Mstart color #9d38bd, M, end color #9d38bd is at \purple{(2.5, -1.5)}(2.5,1.5)start color #9d38bd, left parenthesis, 2, point, 5, comma, minus, 1, point, 5, right parenthesis, end color #9d38bd.Point \purple{M}Mstart color #9d38bd, M, end color #9d38bd is the midpoint of point \blue{A}Astart color #6495ed, A, end color #6495ed and point \green{B}Bstart color #28ae7b, B, end color #28ae7b.What are the coordinates of point \green{B}Bstart color #28ae7b, B, end color #28ae7b? Let f(x) = 16 x^2, g(x) = 4 x. Find (fg)(x) and its domain. can you guys please help me with this and fast?125? which gender has a higher heart rate? The intervention of _ was a turning point in the Thirty years war.A. SpainB. FranceC. England D. Prussia Why did North Korea invade South Korea? Why did Americans need to use the Mississippi River and New Orleans? Metamorphic rocks with a non-foliated texture show metamorphic change that involves ____.a.mineral grains arranging into layersb.growth in the size of the mineral grainsc.mineral grains flattening under pressured.mineral grain melting