which of the following can lower the carrying capacity of a particular area?

Which Of The Following Can Lower The Carrying Capacity Of A Particular Area?

Answers

Answer 1

Answer:

honestly I think its C smaller organisms .I could be completely wrong so keep that in mind


Related Questions

Give two examples of why water is important to the human body.

Answers

Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.

Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)

Answers

Mushu is a definitely answer

Answer:

Mushu

Explanation:

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.

At least 3 paragraphs.​

Answers

Answer:

the water would evaporate and the water would be gone

Explanation:

hope this helps

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

Using the diagram below, how many electrons will Be have if it is a neutral atom?

Answers

the answer is six electrons

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.

Answers

I Am Not Sure What Your Asking?

Answer:

Black Fur & Black Eyes: 4/16

Black Fur & Red Eyes: 4/16

White Fur & Black Eyes: 4/16

White Fur & Red Eyes: 4/16

4 is 1/4 of 16

Explanation:

I hope this helps


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?

Answers

Answer:

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of  the process of cellular respiration. And what happens to the other 66% is that it's  used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat

Explanation:

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.

What is H₂O - H₂+ boz

Answers

Answer:

-tH2

H20 - H2 + boz

0-H2t

-tH2

Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow​

Answers

Answer:

The correct answer is d*ke

Explanation:

I tried the other answer and got it wrong, this was the right one on the test.

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

Other Questions
Which of the following is an equivalent expression to the given expression using the commutative property of addition?2(xy)+5xQuestion 1 options:(xy)2+5x(2x)y+5x5x+2(xy)x(2y+5) Which of these statements describes a disadvantage of a traditionaleconomy? *Everyone knows their role.New ways of doing things are encouraged.New ways of doing things are discouraged.Difficult economic decisions are made by the state. What are some actions that may be taken by a nation to reduce interest rates in a country? Read the Mexican governments Bustamante Decree of April 1830.Article 9. The introduction of foreigners across the northern frontier is prohibited under any pretext whatsoever, unless the said foreigners are provided with a passport issued by the agent of the republic at the point whence the said foreigners set out.Article 10. No change shall be made with respect to the slaves now in the states, but the Federal government and the government of each state shall most strictly enforce the colonization laws, and prevent the further introduction of slaves.What was the main reason the Bustamante Decree changed the minds of people who wanted Texas to become part of the United States? It complicated the balance of potential slave and free states in the United States.It showed that Mexico was prepared to defend its land against foreigners.It showed that Mexico was eager to take immigrants from the United States.It was a declaration of war since Mexico was trying to regulate US citizens. question 6, i dont know what this means and anyone who may know please answer asap :) how do you turn a vertical image to a horizontal image? 0.571428 is or is not the decimal equivalent of 47 . Write your answer in the space provided. The probability of event A is 0.2 and probability of event B is 0.3. Given that A and B are independent, then the probability of A and B (A intersection B) is: Choose one 10 points 5% 6% 9% 13% find three consecutive numbers whose sum is 84 Uno dos one two e rChicken nuggets. Texas Corporation is undergoing a complete liquidation and distributes land to Robert, one of its shareholders, in exchange for all of Robert's stock. The land has a basis of $300,000 and an FMV of $400,000 on Texas Corporation's books and is subject to a $325,000 liability. Robert assumes the liability on the property. Robert's basis in his Texas Corporation stock is $100,000. What is the amount of gain or loss recognized by Robert on the distribution?a. $25,000 gainb. $75,000 gainc. $75,000 lossd. $25,000 loss Based on the skeletons from Asikli Hoyuk, what did an agricultural lifestyle do to the human body? List 4 effects of agriculture on the human body:PLS ANSWER NO BS Express the sum of the polymonial 3x^2+15x-56 and the square of the binomial (x-8) as a polynomial in standard form. Megans personal information is shown below according to the following table what is her hypothetical credit score 2 points6. What literary element is used in the following quote from "The Tell-TaleHeart"? "...a low dull quick sound, such as a watch makes when envelopedin cotton." A chess Club with 80 members is electing a new president. Yoko received 72 votes. What percentage of club members voted for Yoko? A cell with two pairs of each set of chromosomes is called a diploid cell. These cells are typically found throughout the body tissues and are called [ germ / somatic ] cells. Scott bought three bags of candy with 75 pieces in each one. He plans to divide all the candy evenly among seven friends. How many pieces of candy will Scott have left for himself? In this assignment, you will have a discussion with at least two peers. Your discussion will be plannedon a topic that all participants have researched. You will then reflect on your experiences planning,speaking, and listening through a written evaluation. You will complete the assignment by submittingyour response.(Write a response that evaluates a group discussion.) What was used as a basket at each end of the gym?Group of answer choicesbuckethula hoopapple basketpeach basket