Which is required for sexual reproduction

Answers

Answer 1

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer 2

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.


Related Questions

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

how does water pollution harm water ecosystems?

Answers

Answer:

the animals die due to the chemicals and stuff in the water

Explanation:

Animals that live in a water ecosystem could get poisoned and die of all the pollution in the water, and all the trash that enters the waters.

Anaerobes carry on whereas aerobes carry on cellular respiration

Answers

Answer:

Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.        

Explanation:

Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.

Aerobic Respiration

Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.

Anaerobic Respiration

Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.

plz help i need it i have to turn it in tomorrow

Answers

1.Gravity

2.spheres

3.bigger

4.planets

5.ground

6.interia

7.straight

8.force

9.direction

10.holds

11.balance

GOOD LUCK !

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

What are some environmental indicators?

Answers

Biological diversity, food production, average global surface temperature and carbon dioxide concentrations in the atmosphere

You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes

Answers

The answer would be A.thunderstorms

Hope this helps

Have a great day/night

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

how do gray whales migrate?

Answers

Answer:  Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.

Explanation:

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

DNA stands for eoxyrevolution acid deoxyribonucleic acid.

Answers

Answer: yea im  or re.tarded

Explanation:

Answer:

Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around. RNA strands are created using DNA strands as a template in a process called transcription,

Explanation:

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

List body external and internal defenses

Answers

Answer:

External would be skin, nose hair, etc. Internal is white blood cells and bacteria that the body makes to help prevent infections.

Explanation:

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

In this lab, you will simulate birds with three
different beaks. After watching the birds feed, you
will remove fruit to simulate a change in the
environment. What question are you answering by
doing this observation? Write it by filling in the
blanks below.
What is the effect of

on..

Answers

By looking at how the birds interact with fruits in different environment, you can determine where birds are from, what beaks specialize in eating what kind of food, and how those traits came to be (Darwinism)

Answer:

1.

The independent variable is the type of food available.

2.

The dependent variable is the frequency of each type of beak (or number of birds with each beak type).

Explanation:

ong

In the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water

Answers

Answer:

50% water and 50% vinegar

Explanation:

During which phase of mitosis do the chromosomes pull away from the middle of the cell?

Answers

In Anaphase of mitosis chromosomes pull away from the middle of the cell.

During this period the replicated chromosomes are split and moved to the opposite poles of the cells.

What is mitosis?

It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.

What are chromosomes?

It is along DNA molecule with part or all of the genetic material of an organisms.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ2

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell?
A. DNA activates nerve signals in the nervous system
B. DNA speeds up chemical reactions and lowers activation energy
C. DNA protects the cell from invaders.
D. DNA determines what proteins are made.

Answers

Answer:

The answer is D: DNA determines what proteins are made.

Explanation:

The nucleotide sequences that make up DNA are a “code” for the cell to make hundreds of different types of proteins; it is these proteins that function to control and regulate cell growth, division, communication with other cells and most other cellular functions.This process is called protein synthesis.All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.

Hope this helps!! ;)

DNA controls the cell by determining what protein are synthesized by the cell. Thus, the correct option is D.

What is Translation?

Translation is the process of synthesis of proteins from the mRNA (messenger RNA) of the cell. This process occurs in the ribosome of the cell. In this process, the mRNA produced from the DNA encodes amino acids which join together to form large polypeptide and protein molecules.

mRNA are produced from DNA through the process of transcription. Transcription occurs in the nucleus of the cell. Through this process, DNA produces a sequence of mRNA which is complementary to it. This mRNA determines what proteins will be synthesized by the cell.

Therefore, the correct option is D.

Learn more about DNA here:

https://brainly.com/question/264225

#SPJ6

Which is more concentrated in starch beaker or tube?

Answers

Answer:

beaker

Explanation:

it is more concentrated

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

Other Questions
SynthesisDecompisitionO CombustionO Single DisplacementO Double Displacement Multiply The polynomials. (3x^2+4x+4)(2x-4) What is the distance from Mto N? Which of the following statements is true about hydrogen and salt? *a .Both hydrogen and salt are elements.b, Both hydrogen and salt are compounds.c Hydrogen is an element and salt is a compound.d. Hydrogen is a compound and salt is an element. French fill-in the blanks passe composeMon collgue et moi ______ sur les lieux de l'incendie, et je _______ tout de suite interroger le chef des pompiers. Des gens _________ par la porte de l'immeuble en hurlant et d'autres ___________ par la fentre. Deux jeunes filles _________ par les escaliers avec leurs parents. Elles _________ devant moi et je leur ai parl. Elles taient tristes. Leur voisin __________, mais heureusement, le bb qui _________ il y a deux semaines et sa maman vont bien. Les jeunes filles __________ dans la voiture de leurs parents et __________. Mon collgue et moi _________ jusqu' la fin, puis je ________ pour crire mon article.Words: aller, arriver, descendre, monter, mourir, natre, partir, passer, rentrer, rester, sortir, tomber Read the excerpt from Hemingways A Farewell to Arms.Outside it was getting dark. I asked what time the attack was to be and they said as soon as it was dark. I went back to the drivers. They were sitting in the dugout talking and when I came in they stopped. I gave them each a package of cigarettes, Macedonias, loosely packed cigarettes that spilled tobacco and needed to have the ends twisted before you smoked them. Manera lit his lighter and passed it around.What about the actions of these men exemplifies them as Hemingway heroes?They talk about the oncoming attack, clearly with a deep sense of worry for their own safety and the safety of others.They have not yet lived through a battle and are naive about the imminent danger that awaits them.They have the bond only men in battle can share, and this is related by the way they partake of the cigarettes.They act casually and go about regular business, such as smoking, while actually in grave danger. The storage of water in pore space beneath the ground I CANNOT DO THIS, PLEASE HELP! :D . here's the photo. o If Albert Enstein has 53 socks in his drawer: 21 identical blue, 15 identical black and 17 identical red. The lights are out and he is completely in the dark. How many socks must he take out to make 100 percent certain he has at least one pair of black socks? 8. Read the statement below.[All political power is inherent in the people, and allfree governments are founded on their authority, andinstituted for their benefit.]The statement above reflects which of the following principles?answer choices above The angle measurements in the diagram are represented by the following expressions.BSolve for x and then find the measure of What kind of performance involves reading a story as though it is play, with different people reading different characters lines of dialogue? WILL GIVE MONEY GIVE ME CASH APP PLSreaders theaterstorytellingimprovisationdress rehearsal do you think society would be better off if people had more of an interest in history? Where in Nebraska was the oldest known species of horses found? * Question 2 Find three consecutive odd integers whose sum is 99. PLEASE HELP !!!! :((((I WILL MARK BRAINLIEST10 POINTSWhich sentence option is punctuated correctly?A. The explorers' greatest enemies were bands of bearded thieves otherwise known as pirates, who launched surprise attacks in the middle of the ocean to empty ships of their treasures.B. The explorers' greatest enemies were bands of bearded thieves, otherwise known as pirates who launched surprise attacks in themiddle of the ocean to empty ships of their treasures.C. The explorers greatest enemies were bands of bearded thieves, otherwise known as pirates, who launched surprise attacks in themiddle of the ocean to empty ships of their treasures.D. The explorers' greatest enemies were bands of bearded thieves otherwise known as pirates who launched surprise attacks in the middle of the ocean to empty ships of their treasures. Once our rivers,abounded with fishes,___? What is the image of (8,8) after a dilation by a scale factor of 1/2 centered at the origin? The value of the square root of 14 is between which two integers?