Which details from the scene with the scarlet ibis foreshadow Doodle’s death? Check all that apply.

Doodle is curious about what the bird is and where it came from.
The scarlet ibis shares many characteristics with Doodle, and it dies.
The bird has an unusual, exotic beauty, which suggests that it is from somewhere far away.
Aunt Nicey says, “Dead birds is bad luck,” suggesting that now something bad will happen.
Only Doodle cares about taking care of and burying the scarlet ibis.

Answers

Answer 1
The answers are definitely two and four, and possibly 5

Related Questions

Write ten words which have the /ea/ sound. leal /ea/​

Answers

Answer:

leaf, teal, heel, meal, seal, feel, peel, meet, meat, seek

Explanation:

Ryhmes

Read the excerpt from Brown v. Board of Education.
Therefore, we hold that the plaintiffs and others similarly situated for whom the actions have been brought
are, by reason of the segregation complained of, deprived of the equal protection of the laws guaranteed by
the Fourteenth Amendment.
Why does the Supreme Court conclude that the plaintiffs have been denied their rights?
O The plaintiffs' schools have neglected their responsibilities.
O The Fourteenth Amendment fails to reference education.
Segregation is inherently unequal and unfair.
The plaintiffs' children have endured racial stereotyping.

Answers

The reason the Supreme Court conclude that the plaintiffs have been denied their rights is The court recognizes that the current delivery of education might compromise citizens' rights

What is an excerpt?

An excerpt refer to words, statement or ideas that is extracted from a literature which has meaning.

Therefore, The reason the Supreme Court conclude that the plaintiffs have been denied their rights is The court recognizes that the current delivery of education might compromise citizens' rights.

Learn more about excerpt below.

https://brainly.com/question/21400963

#SPJ1

Based on this passage, which values seem to be most important to the Māori?

freedom and individuality
togetherness and love
killing and war
sacrifice and unhappiness

Answers

Based on this passage, the values that seem to be most important to the Māori are freedom and individuality. The correct option is A

Who was Maori?

Maori is a character of an animated movie, Moana. He was the Demi god in the movie. He was powerful and funny. He was free and in his childhood he was left by his mother.

Thus, the correct option is A, freedom and individuality.

Learn more about Maori

https://brainly.com/question/2527144

#SPJ1

Answer:

A: freedom and individuality

Explanation:

just did it

Which term describes the arrangement of words and phrases to create well-formed sentences?
syntax
logic
grammar
style

Answers

Answer:

use Quizlet  

Explanation:

it helps

Answer:

Syntax

Explanation:

Syntax, is the arrangement of words in sentences, clauses, and phrases, and the study of the formation of sentences and the relationship of their component parts.

Which sentence should be rewritten to use the active voice?

Answers

Sentences that should be rewritten using active voice are those in which the subject is important.

What is the difference between the active and the passive voice?

In the active voice, the sentences start with th subject, while in the passive voice, the first element is the object affected by the action.

For example:

Annie buys flowers (Active voice)Flowers are bought by Annie

When should sentence be rewritten in the active voice?

If the subject is known and it is important the sentence should be rewritten in the active voice. For example:

Da Vinci painted the most famous painting in the world

rather than

The most famous painting in the world was painted.

Note: This question is incomplete because the sentences are not given; due to this, the answer is based on general knowledge.

Learn more about active voice in: https://brainly.com/question/18692556

#SPJ1

Select the correct anwser from the speech by Barbara Jordan
Which audience does the passage most likely target? A. business leaders B. community members C. students D.politicians​

Answers

Answer: I think it might be D

Explanation: Because it says Barbra is a politician so maybe she was making her speech because she was talking to other politicians.

Sorry if it's wrong

have a nice day!

Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisa’s guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals.

Answers

Answer: A, so she could see her personal vision and plan achievable goals.

Explanation: Pls mark brainliest

Answer:

a

Explanation:

why the death penalty is good ​

Answers

Answer:

Justice requires that society impose on criminals losses equal to those they imposed on innocent persons. By inflicting death on those who deliberately inflict death on others, the death penalty ensures justice for all.

Explanation:

Answer:

Human civilizations have used the eath penalty in their set of laws for over 4,000 years. There have been times when only a few crmes receive this consequence, while some societies, such as the seventh century B.C.’s Code of Athens required the punishment for all crimes to be deat

Today, capital punishment is reserved for brutal and heinous crimes

Explanation:

The dath penalty in the United States came about because of the influences of the colonial era. The first recorded eecution in the colonies occurred in 1608 in Jamestown. Captain George Kendalecuted for being a spy for Spain. It only took four more years for Virinia to institute the deat penalty for minor offenses such as stealing grapes or trading with Native Americans.

Find the meaning of the word: parable

Answers

Answer:

A parable is a short story that teaches us something. For example, there is the parable of the Good Samaritan.

How does our modern, Western society compare to late 19th century Igboland when it comes to viewing others as humans beings?

Answers

Answer:

no slavery

Explanation:

What noted poet had only 10 poems published in her lifetime?.

Answers

Answer:

Emily Dickinson

in 100 words explain how shakespeares irony creates tension in romeo and juilet

Answers

Answer:

well their love for each other had been inseperateable which they would pull through all the negative and positive triumphs

Explanation:

When engineers design solutions to problems ( bridge a river , support a building , etc.) there are always certain conditions which they must work under. for example there may be a limit to funds, space labor , or technology or there may be environmental restrictions to observe. these conditions are most generally referred to as design

Answers

The condition under which the engineers have to face in form of restrictions are referred to as design constraints.

What is a design constraint?

This is the term that is used to refer to the factors that most be put in place in order for a project to be successful.

The constraint as it is used has to do with the limitations that face the project that is being carried out.

Read more on design constraints here:

https://brainly.com/question/6073946

#SPJ1

Write an analytical essay in which you analyze and evaluate the techniques used in ww2 propaganda.

Answers

Answer:

To meet the government's objectives the OWI (Office of War Information) used common propaganda tools (posters, radio, movies, etc.) and specific types of propaganda. The most common types used were fear, the bandwagon, name-calling, euphemism, glittering generalities, transfer, and the testimonial.

Explanation:

Why was Tom relieved when both Jeff and Jessica were absent? Chapter 10 Firegirl

Answers

Answer:

. who knows you should study before the test

Explanation:

Now open your book and find it yourself

A formal tone is most appropriate to use in
.

Answers

Answer :-

you should use the kind of languages would use when giving an important speech, not the kind of language you might use when talking with close friends. A formal tone helps establish the writers respect for the audience and suggested that the writer is serious about his or her topic.

I hope it I helps you.

Answer: conversation

Explanation:

Write an algorithm to solve the below problem:

You get a new dog, and you need to build it a new home. List all the steps required to construct a doghouse on your own. You may not buy a doghouse kit. You must include a minimum 100 steps.

You must list a minimum of 10 conditions at the bottom of your list that will be included as part of your process.

Answers

To build a new dog home you have to buy them food and beds and in order to do that you could either build the home in your personal bathroom or a quiet place.

Can anyone please help me about “Should protective headgear be mandatory in soccer?” Essay

Answers

I will gladly help
Yes headwear should be in soccer because when you fall it’s better to hit your head when it’s in something less damage that way so instead of hitting your head you hit a helmet instead hopes this helped

What happened to Salamanca's mother? Question 1 options: She died in a train accident She died in a car accident She died in a bus accident She died in a plane accident

Answers

The Salamanca's mother was died in a car accident.

What was the cause of Salamanca's mother's death?

Mrs. Cadaver was sitting next to Salamanca's mother and was the lone survivor of the bus catastrophe, was killed in the terrible car accident. To preserve her life, Salamanca's mother had to get a hysterectomy.

Salamanca, known as a Native American collection, her mother had told her as she gazes out over the Badlands. Salamanca and her grandfather travel to Ohio, and Sal, her father, and her grandfather return to Kentucky after finally resolving their differences.

Therefore, option B is correct.

Learn more about the Salamanca, refer to:

https://brainly.com/question/7180730

#SPJ1

In her rush to get to work, she forgot to take her keys. their decision to move to arizona was ; the heat nearly killed them that first summer. the scream came from the apartment across the hall. the clothes were , but dana didn’t have the time to go shopping.

Answers

This exercise tests the ability of the student to fill in the correct words. Hence the correct answer is (Option B)

What is the corrected Sentence?

The corrected sentences using words from Option B are:

1. In her frenetic rush to get to work, she forgot to take her keys.

2. Their decision to move to Arizona was shabby; the heat nearly killed them that first summer.

3. The piercing scream came from the apartment across the hall.

4. The clothes were egregious, but Dana didn’t have the time to go shopping.

See the attached for the full question.

See more about fill in the gaps at
https://brainly.com/question/24343382
SPJ4

What does the context suggest is the most likely meaning of wretched as it is used in this excerpt from “The New Colossus”?

Give me your tired, your poor,
Your huddled masses yearning to breathe free,
The wretched refuse of your teeming shore,
Send these, the homeless, tempest-tossed to me. (lines 10–13)

a
rebellious
b
elderly
c
miserable
d
industrious

Answers

Answer:

The answer would be D(Industrious).

Explanation:

Hope this helps!

Which topic below would be a good one for a demonstration?

steps for safety during an earthquake

why frogs sing after it rains

what to look for in a pet

where Canada is on a map

Answers

Answer:

Steps for safety during an earthquake.

Explanation:

A topic that would be a good one for a demonstration is A. steps for safety during an earthquake.

What is a Topic?

This refers to the heading that is used to give information about the contents of a text.

Hence, we can see that when making a text that would be good for a demonstration, one would have to use option A because it shows the steps for safety during an earthquake.

Read more about topics here:

https://brainly.com/question/540693

#SPJ2

Based on the article below answer this question:
" Which of the following aspects of the article is NOT thoroughly discussed?"
What Hector has already done as a community organizer.
What Hector has already done as a community organizer.

Why some opponents do not support Hector.

What Hector wants to do if elected.


What Hector thinks about her opponents.

Answers

One aspect of the article that was not discussed in detail was What Hector thinks about her opponents.

What did the article on Hector speak on?

We found out about the reason why some opponents don't support Hector which was that she was young.

We also found out how she had impacted her community. We did not however find out what she thought of her opponents because the article focused on her reasons for running.

Find out more on analyzing articles at https://brainly.com/question/1542515.

#SPJ1

What argument did Andrew Jackson use to persuade people that the Indian removal act was a good decision ?

Answers

Answer:

Jackson argued that if Native Americans were removed, white settlers would become wealthier.

Explanation:

He argued that removing American Indians will allow white settlers to become wealthier.

What is the main theme of the short story “Showdown” by Shirley Jackson?

Answers

Answer: The theme of "Showdown With Big Eva" is to be yourself, don't try to change yourself. There is somebody out there who will accept you for who you are. In the story, it told how Big Eva hated herself, how she never get any attention at home, and the ugly front she had created to scare off the world

A connective may never be the first word of a sentence.


TrueFalse

Answers

Answer: False

Explanation: A connective may be used as the first word of a sentence. *After* dinner you must do your homework.

Which of the following best represents catharsis?

-emotional release
-happily ever after
-conclusion
-epilogue

Answers

Answer:

Emotional release.

Hope this helped! :-)

Which of the following statements about turning points in environmental policy is true?
a. Environmental policy has changed over time as a result of pressure from industry.
b. Turning points in environmental policy were typically the result of urban expansion.
c. Turning points in environmental policy have come about through increased public awareness.
d. Environmental policy has changed little over the history of the United States.

Answers

The statement which is true about turning points in environmental policy is that Turning points in environmental policy were typically the result of urban expansion. Thus, the correct option is B.

What are Environmental policies?

Environmental policies may be defined as any action by a government, corporation, or other public or private association concerning the consequences of human conditioning on the surroundings, especially those efforts that are invented to preclude or diminish the contaminated consequences of human activities on the environment.

The modifications or alterations in the environmental policies are the outcomes of pivoting issues that were generally associated with the expansion of urban areas that enhances the level of environmental pollution.

Therefore, the correct option for this question is B.

To learn more about Environmental policies, refer to the link:

https://brainly.com/question/3316812

#SPJ1

Who will suffer, according to the "Equal Pay Bill" letter, if women make the
same money as men?

A. Young professional women

B. People earning minimum wage

C. Families and society

D. College students
SNBMIT

Answers

Answer:

families and society

Explanation:

I've done this quiz before.

What and promises and why do we keep them?

Answers

Answer: Heyaa! ~

Promises are assurance that one will do a something or  a particular thing will happen.

Explanation:

sense when did we keep promises....

don't keep promises people need to hear the truth no matter the situation...

Hopefully this helps you! ^^

Answer:

They are things u say to people and u must keep what u say

Explanation:

we keep them bc it would be a sin not to

Other Questions
Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain.