Answer:
The nervous system takes in information through our senses, processes the information and triggers reactions, such as making your muscles move or causing you to feel pain. For example, if you touch a hot plate, you reflexively pull back your hand and your nerves simultaneously send pain signals to your brain
why would an athlete need to be concerned about a twitch or sustained contraction
Answer:
why an athlete would need to be concerned about twitches or contractions is because, whenever they perform, and such thing happens, it will most likely distract the athlete, and cause the athlete doing his/her performance to not be as good, and may lead to failure, for example, when someone is running very fast for a sprinting race, and he has a contraction in his leg it will cause him to react by showing signs of pain by slowing down or even tripping and falling, causing him to lose the race.
Hope this Helped!
Which statement best describes Mendel's principle of segregation?
Answer:
Inherited traits are controlled by two factors that separate during reproduction.
Explanation:
Sean and Catherine have 4 kids. Each kid has a different blood type. The public immediately assumes that Sean couldn't be the father. is this necessarily true? Use Punnett squares to show your work for if it is possible for them to have these 4 kids.
PLEASEEEE HELPPP!!!!!
As Sean and Catherine have four kids and each is different blood type. The public assumes Sean as father and Catherine as mother which is not necessary true.
The Puneet square is a helpful method to predict the variations and probability of cross-breeding. There could be possibly four changes such as blood group of Sean is A and Catherine is B then. Dominant blood group be found AA, AB, A an B blood group.Learn more about Catherine have 4 kids.
brainly.com/question/20757353.
Using the data provided, how can we describe the difference between amplitude of an average wave in location B?
Compared to location A, an average wave in location B
A.
has more distance between it and the next wave.
B.
has less energy.
C.
is higher from the bottom to the top of the wave.
D.
has less distance between it and the next wave.
Answer:
has less distance between it and the next wave
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years?
A.
The Grand Tetons will stay exactly the same as they are today.
B.
The Grand Tetons will become steeper and more rugged.
C.
The Grand Tetons will become less steep and more rounded.
D.
The Grand Tetons will become much taller than they are today.
Answer:
the correct answer to the question in c
Answer: C)The Grand Tetons will become less steep and more rounded.
Explanation:
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years? C)The Grand Tetons will become less steep and more rounded.
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation:
what in your dna are responsible for determining the traits that are expressed in an organism
1. mutagens
2. replication
3. cell
4. gametes
5. genes
6. meiosis
Answer:
Genes
Explanation:
Gene. A segment of a DNA molecule (a sequence of bases) that codes for a particular protein and determines the traits (phenotype) of the individual. A gene is the basic unit of heredity in a living organism.
Which statement best describes the overall chang
O One cell becomes two cells that have identical
OOne cell becomes two cells that have different
O Two cells become tWo cells that have identical
O Two cells become two cells that have different
Answer:number one
Explanation:
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations
Answer:
C. Somatic
Explanation:
hope it helps ya :D
What is the net ATP gain at this stage of cellular respiration?
2
4
32
36
Answer:
The answer is A.) 2, Edge 2022
Explanation:
The net ATP gain at this stage of cellular respiration is 36. Therefore, option "D" is correct.
What is cellular respiration?A series of chemical reactions known as cellular respiration breaks down glucose into ATP, which can be used as energy to power numerous body processes. Cellular respiration has three main stages: the citric acid cycle, glycolysis, and oxidative phosphorylation.
In eukaryotes, the 4 phases of cell breath incorporate glycolysis, progress response (pyruvate oxidation), the Krebs cycle (otherwise called the citrus extract cycle), and oxidative phosphorylation through the electron transport chain.
Therefore, cellular respiration is the main process that generates ATP and gives energy to the body to work.
Learn more about cellular respiration, here:
https://brainly.com/question/29760658
#SPJ7
Fossil fuels, such as oil and natural gas, are primarily formed from the remains of what?
phytoplankton
mammals
bacteria
dinosaurs
Answer:
phytoplankton
Explanation:
Answer:
Its phytoplankten.
Explanation:
I hope I spelled it right
from his monohybrid crosses, Mendel developed his first law
Answer:
Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied
Explanation:
How does sexual reproduction increase the variance of traits in a population?
explain the process of digestion abd absorption of carbohydrates.
Answer:
Carbohydrate digestion breaks down disaccharides (sugar) and complex carbohydrates into a simpler sugar so it can be absorbed. But not all are completely absorbed in the small intestines.
Explanation:
4.
What is the importance of biodiversity to humans and to ecosystems?
Answer:
Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.
Explanation:
looked it up
What are the products of photosynthesis?
Answer:
glucose and oxygen
Explanation:
just aced a unit test on this subject
an atom that has gained or lost one or more electrons
This is called an ion. :)
18. Viruses are considered
because they can not perform the characteristics of life without a
19. Viruses are made of two basic compounds,
and a
made of protein.
20. A virus infects a cell by injecting
into a cell.
Answer:
6. antibodies and DNA for the question no.6
Please help me on this question
Bam hi cuts between what bases
Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment. What relationship is shown here between the mistletoe and the tree?
A.Competition
B.Parasitism
C.Mutualism
D.Commensalism
Mistletoe extracts water and nutrients from the spruce, to the spruce tree's detriment. The relationship that is shown here between the mistletoe and the tree is Parasitism. Hence, the correct option is B.
What is Parasitism?Parasitism refers to a type of symbiotic relationship in which one organism benefits at the expense of the other organism, which is called host. The parasite lives on or inside the host and derive nutrients as well as shelter from the host, thereby providing no benefit to the host in return.
Examples of parasites includes tapeworms, roundworms, lice, fleas, and some species of bacteria and viruses.
Parasitism is a common for of symbiosis in nature and play an important role in shaping the relationships between species and maintaining balance in ecosystem. Hence, the correct option is B.
For more details regarding parasitism, visit:
https://brainly.com/question/29759870
#SPJ6
A geneticist crossed pure breeding black mice with pure breeding brown mice. All the mice in the F1 generation had black coats. When these mice were crossed, they yielded 961 black coated mice and 317 brown coated mice.
Fill in the new combinations of alleles in the F2 generation.
Answer:
The correct answer is - the brown allele is not independent from the black allele and disappears in the F1 generation.
Explanation:
IN this question it is given that there is a cross between pure black and pure brown breed and the F1 generation has all-black coat offspring and their self cross produced 961 black and 317 brown.
The black coat offspring is three times than the brown coat offspring in F2 generation which means they have 3:1 ratio that comes in the self cross of heterozygous only there for the F1 generation black coat offspring have the heterozygous genotype for the trait,
Thus, the brown allele is not independent of the black allele and disappears in the F1 generation.
The most common presenting sign/symptom with rheumatic fever is a. rash. b. painless nodules. c. polyarthritis. d. cardiac murmur.
Answer:
c. polyarthritis.
Explanation:
Rheumatic fever is an inflammatory disease that may affect different parts of the body including joints, heart, brain, and skin. It is a rare disease observed after a bacterial throat infection caused by Streptococcus (group A). The most common signs of this disease include swollen and/or tender joints (i.e., polyarthritis), especially in wrists, knees, elbows or ankles, fever, fatigue, pain in the chest, breathlessness, palpitations, etc. Rheumatic fever needs to be treated by antibiotics to eliminate group A Streptococcus infections.
Which of these species might be classified as a pioneer species ? A.Choke cherry B.ponderosa pine C.Aspen D. Lichen
Answer:
aspen
Explanation:
Answer:
lichen
Explanation:
they are the first to grow on bear rock
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
What phase is mitosis in
Answer:
prophase, prometaphase, metaphase, anaphase, and telophase.
Explanation:
Which relationship is an example of commensalim?