When did you have to be 21 to vote?

Answers

Answer 1

It established that "American citizens who are eighteen years of age or older" have the right to vote and lowered the voting age from 21 to 18.

What do you voting for?

Voting is a procedure that a group, such as an electorate or gathering, can utilize to come to an agreement or express a viewpoint, usually following discussions, debates, or election campaigns. Democracies choose their high-level officials through the electoral process.

Which right is called right to voting?

Each citizen's right to participate in the management of public affairs, the right to vote and be elected, and the right to access public service are all recognized and upheld by Article 25 of the Covenant.

To know more about vote visit:

brainly.com/question/21093353

#SPJ4


Related Questions

Essay on civil and criminal laws on malaysia?

Answers

Answer:

are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.

Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.

Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences

Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.

Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.

Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.

A mixed legal system is a mixture of two or more legal system practised by some countries.

2.0 Malaysia’s Legal System

Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.

laws pertaining to persons professing the religion of Islam.

Share this:

Cite This Work

To export a reference to this article please select a referencing stye below:

OSCOLA

APA

MLA

MLA-7

Harvard

Vancouver

Wikipedia

All ltd, 'L

Trustedsite Law

A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.

Answers

Is it a fluorescence microscope ?

In a violent culture, the level of “background violence” is _____.
Group of answer choices

Answers

Answer: Violent culture is associated with social disputes.

Explanation:

In a violence culture the background violence includes the reason for violence. It can be because of lack of literacy, stress, financial crisis, family and neighborhood dispute, domestic dispute, jealousy, criminal conduct, argument, racial discrimination, abuse of powers, alcoholic aggressive behavior and disputes, social injustice, gender discrimination, and other reasons. These reasons promotes the violent culture.

What can people do if they feel that a law is unfair?

Answers

People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
hope this help!

Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.

The primary job of the legislative branch is to

Answers

Answer:

The legislative branch drafts proposed laws, confirms or rejects presidential nominations for heads of federal agencies, federal judges, and the Supreme Court, and has the authority to declare war.

Explanation:

Hope this helps and have a wonderful day!!!

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35​

Answers

Answer:

It is C.30 years old

Explanation:

Answer: to be senator you must be over the age of 30 years old. To be represenative a person must be 25 of age or older.
Explanation:This is specified in the U.S. Constitution. Most states in the U.S. also have age requirements for the offices of Governor, State Senator, and State Representative.


Please give me brainlyyy❤️❤️

What is the first step to reducing risk in the highway transportation system?
A. The first step is to understand what are the risks.
B. The first step is to understand what traffic signs mean.
C. The first step is to understand when to brake.

Answers

I think it’s b not so sure tho :/ could I get Brainly?/ the crown on top of the comment??

____ and ____ are the two forms of contracts.

Answers

Answer:

fixed price contracts and cost-reimbursement contracts

19. To bring a derivative suit, a shareholder must own stock at the time of the
A. injury and at the time of the suit.
B. injury only
C. suit only
D. trial, suit, and injury

Answers

Answer:

A. injury and at the time of the suit.

Explanation:

A corporation can be defined as a corporate organization that has facilities and owns or controls assets used for the production of goods and services in at least one country other than its headquarter (home office) located in its home country.

This ultimately implies that, a corporation is a corporate organization that owns or controls its business in two or more countries.

One of the advantage of a corporation is that, owners have limited liability for debt to the extent to which they have invested and as such are not personally liable for some of the debt owed by corporation.

A derivative suit can be defined as a lawsuit that's brought forward by a shareholder on behalf of a corporation, to either defend or enforce a legal right (claim) against a third party such as a director or executive officer in the corporation.

Hence, to bring a derivative suit to a court of competent jurisdiction, a shareholder must own stock at the time of the injury and at the time of the suit.

The rights of people accused of a crime are protected in the Bill of Rights. Choose ALL true statements about how the Bill of Rights protects the rights of the accused.

A) Punishment for a crime must be fair and appropriate.

B) People accused of crimes can choose their own juries.

C) Searches and seizures of people's property must be lawful. Eliminate

D) Trials must be fair and speedy, and include a jury of peers.

E) Under no circumstances is a person's property to be searched.

Answers

Answer:

B, C and D

Explanation:

C is Protection from Unreasonable Searches and Seizures ( amendment 4)

D is- Rights of Accused Persons in Criminal Cases (Amendment 6)

B is- public trial by an impartial jury (amendment 5)

A is not covered under the BoR

E: you can be searched if there is probable cause

Answer:

the answer is a, c, and d

Explanation:

Who is most likely to follow public opinion polls to help them make decisions? Members of the House of Representative, Senators or the President? Why?

Answers

Answer:

The President is the one who is most likely to follow opinion polls when making government decisions, given that it is a one-man and clearly personalist position, which means that, in case of making decisions that are contrary to the majority opinions, it will impact decisively in its political image in the face of society. On the other hand, both the Senate and the House of Representatives are plural organisms, with which their members are less individualizable and, therefore, are less exposed to public opinion.

Answer:House of Representative members

Explanation:

Representatives run for election every two years and must constantly raise campaign money. They abide by public opinion because do not have time to explain their actions or mend fences before each election.

Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!

Answers

This is protected under the first amendment. When a flag is privately owned, the owner should be able to burn it if the owner chooses, especially if this action is meant in the form of protest. Congress responded to the Johnson decision by passing a Flag Protection Act, only to see the Supreme Court reaffirm Johnson by the same 5–4 majority in United States v. Eichman, declaring that flag burning was constitutionally protected free speech.

examination of bill of entry is done to vouch​

Answers

Answer:

What? I Don't understand

Explanation:

Answer: Custom !!!!!

What is element identification in the legal practice?

Answers

Answer:

this is what I found online:

"Element Identification is a helpful skill to decide what action is needed…… (IE levels of research via sources and or investigation.) By taking each legal situation and breaking. From this point you may begin identifying the. legal issue of the complaint/case."

Which of the following is a belief held by the theory of natural law?

Answers

According to natural law theory, all people have inherent rights, conferred not by act of legislation but by "God, nature, or reason." Natural law theory can also refer to "theories of ethics, theories of politics, theories of civil law, and theories of religious morality." Natural law has roots in Western philosophy.

Natural law - Wikipediahttps://en.wikipedia.org › wiki › Natural_law

A polygraph test is conducted, and the findings indicate that there is an 80 percent chance of deception. What does this mean for the investigation?

a) The suspect is guilty and should be arrested for the crime.
b) The suspect is probably just nervous since 80 percent is a pretty high number and usually indicates a false positive.
c) The suspect might be guilty, but more information is needed from other parts of the investigation.
D)There has been a mistake in the polygraph test, and the test should be conducted again to get better results.

Answers

Answer:

c

Explanation:

Which of the following is considered a risk of driving?
A. Spending too much on gas
B. Getting lost
C. Causing damage

Answers

C I feel... I don’t know tho:/

PLEASE ANSWER WILL GIVE MOST BRANLIST WHO ANSWER CORRECT!!
(NO LINKS)


Which of the following aspects of the article is NOT thoroughly discussed?

A
how new amendments can be ratified
B
why support for the ERA diminished
C
how gender discrimination affected women
D
why some people chose not to support the ERA

Answers

Can you add a picture of the article please?

what is the example of red lie?​

Answers

red lie are lies to harm others

Explanation:

example:

Danice: Mr William Jake took your phone and smashed it on the ground

Mr William: What?

* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*

Hope it helps

A claim made with full knowledge that the opposing person already knows it to be untrue.

What is a red lie?

Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.

An example of a red lie will is:

Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a  red lie that is presented.

Learn more about red lie, here:

https://brainly.com/question/25427223

#SPJ2

How does Levi from aka help better understand the government

Answers

Answer:

By making it better for others

Explanation:

It’s Ryun he’s amazing ok bye

What can people do if they feel that a law is unfair?

Answers

Answer:

Get them to sign petitions and contact their legislators. If you created a Web presence for your grassroots group, be sure to let your customers know how they can follow you on social media for the latest updates. Additionally, seek other organizations that might have a stake in defeating unfair laws.

Explanation:

Also, while the law is being passed on through all 3 branches the law must go to a vote. Therefore, if you believe the law is unfair you can vote against it.

What is the governments role

Answers

Answer:to do take care of the people

Explanation:

Levi Ackerman is really amazing

While the U.S. Constitution initially gave most of the responsibility for foreign affairs directly to the President, what is the name of the separate Department that was established within the executive branch to handle U.S. foreign relations?
Select one:
A. Commerce
B. Treasury
C. State
D. Homeland Security

Answers

the answer is C (state)

What is a permanent feature if a representative form of government?​

Answers

Answer:

Elections

Explanation:

I would guess that elections are what make a representative form of government actually representative. Without elections, the ones in power would not actually represent the views of the people.

Which question would best be answered by studying an area’s social structure?

A.
Why are crime rates higher in that area than another area?

B.
Why are most crimes committed by men?

C.
Why do crime rates rise during the hottest part of the summer?

D.
What type of personality is more likely to commit a crime?

Answers

Answer:

I think it's option (A) Why are crime rates higher in that area than another area?

Answer:

a

Explanation:

What did Roosevelt believe was the purpose of government?

Answers

Answer: Professor Richard Heffner of Rutgers University noted about Roosevelt that his New Nationalism "sought Social Justice by extending the powers of the central government", which Roosevelt believed to be the steward of the public welfare.
sought social justice by extending the powers of the central government

John sold a pair of skis to Bob, making no specific warranties or promises of any kind other than letting Bob examine and try them. In fact, John did not own the skis; he had only rented them. When the true owner claimed them, Bob demanded his money back. John defended his actions by stating that he had made no warranty of any kind.

Answers

I think that bob should get his money back because John had rented the skis without any permission to sell them by the owner. Even if bob and John had made no warranty of any kind he would still need consent from the owner.

What is the default join type?

Answers

Ans: SQL inner join


The simplest and most common form of a join is the SQL inner join the default of the SQL join types used in most database management systems. It's the default SQL join you get when you use the join keyword by itself. The result of the SQL inner join includes rows from both the tables where the join conditions are met.

Answer:

If this is for edge....it’s A) inner

Explanation:

You want to work in the court, and you have just heard that most cases that come across a prosecutor’s desk never go to trial. What are your options? One of the prosecutor’s jobs is to work with law enforcement officials. Larger offices, as in New York, do tend to have larger cases with more opportunities. Drop the idea of becoming a prosecutor. Learn what other tasks prosecutors do in particular offices or agencies.
multiple choice

Answers

Common law originated from custom and use rather than from written statutes. While American law is based on custom, most jurisdictions have now codified their criminal law via statute and legislation.

Other Questions
(PLEASE HELP) Biodiversity affects the sustainability of an ecosystem by-A. Always Increasing competition for limited resources within the ecosystem.B. Allowing the ecosystem to survive many changes.C. Preventing the ecosystem from surviving many changes.D. Always decreasing competition for limited resources within the ecosystem. An advantage of organization in the u.s. that compete globally is PLEASE HELP!For what values of x are the following expressions equal to each other:the trinomials 3x^2 - 4x +3 and x^2+x+1 7th grade math does anyone got any idea of what this could be Can someone please help I dont understand how to do this thank you PLEASE HURRY!! I HAVE TO FINISH BY 2:00 AND IT IS 1:26Why was the relationship between the United States and the Soviet Union difficult after WWII? Each nation sought support from Germany. Both nations competed with each other economically. Both nations refused to sign a peace treaty. Each nation distrusted and feared the other How did slavery develop and change in Africa The number of bacteria can be represented by the equation A(t)=200(.75)^t, wherr A(t) is the amount of bacteria in grams and t is the number of days. a. Is this function growth or decay? b. What percent is the bacteria decreasing by each day? c. How many grams of bacteria will there be in 1 week? d. After how many days will there be half the initial amount of bacteria left? What is the volume of a square pyramid with a base area of 36 and a height of 9 cm?o 36 cmo 108 cmo 18 cmo 324 cm 9/3Streak8 20th3970If you save $800 in the bank with an interest rate of 4%, how much money will youhave at the end of 5 years? define the term pure substance HELP ME PLEASE!The graph below shows a line graphed through the points Which of the following websites is reliable? 1.Paragraphs always state a main idea with supporting details.O A TrueO B. False2.Arabic numbers are used in outlines.O A. TrueO B. False3.you should never put the date on your notes.O A. TrueO B. False4.Notetaking is done only when you read something.O A. TrueO B. False5.The subheadings are the supporting ideas in an outline.O A. TrueO B. False6. Under no circumstances should you use abbreviations when taking notes.O A. TrueO B. False7. The abbreviation for the Central intelligence agency is CIA.O A. TrueO B. False8. Comparing and contrasting is one way to graphically represent your notes.O A. TrueO B. False9. Permanship ship does not matter when you are taking notes.O A. TrueO B. False10. Margins are often used to__________O A. Color in.O B. Add bits of information.O C.Doodle.O D take notes. THE TOPIC IS: AREA OF CIRCLES!! PLEASE HELP ME WITH THIS QUESTION!!! WHATS THE ANSWER?? I WILL GIVE YOU BRAINLIEST AND A THANKS!!! AND PLS PUT AN EXPLANATION!! THANK YOU what are some of the limitations of using first person perspective multiple choice question pls help! which gas would diffuse rapidly at the same temperature and pressure UF6 or CL2 HELP ASAP!!!!!!!!!!!!!!!!!!!! BRAINLIEST AND 100 PTS!Article 4 of the Texas Constitution states: "The Governor shall ... account to theLegislature for all public moneys received and paid out by him, from any fundssubject to his order, with vouchers; and shall accompany his message with astatement of the same."Which principle does this statement illustrate?checks and balancesfederalismindividual rightspopular sovereigntyTHANK YOU :))))))))))))))))))) Amber coaches soccer and volleyball. She coaches both sports for a total of 10 hours each day. The soccer practice lasts 1 hour more than twice as long as the volleyball practice. Part A: Write a system of equations to model the situation. Use v for the number of hours Amber coaches volleyball in a day and s for the number of hours she coaches soccer. ( Part B: How many hours each day does Amber spend coaching each sport? Show your work. ( Will Mark Brainliest. Only answer if your 100% sure. This is very important).