What was the outcome of the ‘Quit India
Movement’?

Answers

Answer 1
The Quit India campaign was effectively crushed. The British refused to grant immediate independence, saying it could happen only after the war had ended. Sporadic small-scale violence took place around the country and the British arrested tens of thousands of leaders, keeping them imprisoned until 1945.
I only research it

Related Questions

Until the Great Migration of black Americans from the rural South to the urban North during World War I, the vast majority of African-Americans lived in the South.

Answers

Until the Great Migration, which began around World War I and continued through the 1970s, the majority of African-Americans lived in the Southern region of the United States. This was primarily due to the legacy of slavery, which had concentrated the African-American population in the South.

Prior to the Great Migration during World War I, the majority of African-Americans resided in the southern regions of the United States. Before the Great Migration, African-Americans predominantly lived in the Southern states due to factors such as slavery, agricultural labor opportunities, and the establishment of racial segregation laws.

The South had a large African-American population that primarily worked in agriculture and faced significant racial. However, during World War I, the demand for industrial labor in the North, coupled with increased racial tensions and the promise of better economic opportunities, led to a massive movement of African-Americans from the rural South to the urban North.

This migration had a profound impact on the demographic, cultural, and social landscape of both regions.

To learn more about Migration here: https://brainly.com/question/637917

#SPJ11

9
The DP camps provided counseling and mental health services.
OA. True
OB. False
Reset

Answers

The statement ''The DP camps provided counseling and mental health services.'' is false.

The Displaced Persons (DP) camps established after World War II aimed to provide shelter, basic needs, and repatriation assistance to displaced individuals, but mental health services and counseling were not consistently available or prioritized within these camps.

The primary focus of the DP camps was to offer temporary refuge and aid in the resettlement of displaced persons, particularly those who were survivors of the Holocaust or had been forcibly displaced by the war.While some limited medical services were provided in certain camps, including basic healthcare and treatment for physical ailments, mental health services, and counseling were not systematically integrated into the DP camp infrastructure.This lack of dedicated mental health support can be attributed to the challenging circumstances of post-war reconstruction, limited resources, and the general understanding of mental health at the time.

Consequently, many survivors and individuals residing in the DP camps had to cope with the psychological impact of their wartime experiences without specialized mental health services or counseling readily available within the camp system.

For more questions on Mental health

https://brainly.com/question/20273452

#SPJ8

Most of the twentieth century, ________ controlled the political power of latin america.

Answers

For most of the twentieth century, authoritarian regimes or military dictatorships controlled the political power of Latin America.

Throughout the twentieth century, Latin America experienced a significant period of political instability and authoritarian rule. Many countries in the region were governed by military dictatorships or authoritarian regimes that tightly controlled political power. These regimes often came to power through military coups, suppressing democratic processes and civil liberties. The reasons for the rise of authoritarian rule varied, including economic crises, social unrest, Cold War dynamics, and the desire for political stability.

These regimes employed repressive tactics, such as censorship, human rights abuses, and the suppression of opposition, to maintain control. It was only in the later decades of the twentieth century that many Latin American countries began transitioning to democratic systems, with the restoration of civil liberties and the return of civilian governments.

To learn more about authoritarian.

Click here:brainly.com/question/17843506?

#SPJ11

describe one piece of evidence that would support the author’s characterization of russia’s political culture prior to the bolshevik revolution.

Answers

One piece of evidence that would support the author’s characterization of Russia’s political culture prior to the Bolshevik Revolution is the suppression of political opposition. According to the author's characterization of Russia’s political culture prior to the Bolshevik Revolution, the government had a history of repressing its political opposition. It was the autocratic and totalitarian government that sought to maintain its power and authority over the masses through such repression.

The government's use of censorship, propaganda, and the use of violence was widespread during this period to suppress the voices of the political opposition. Political critics, writers, and thinkers were often jailed or forced into exile for speaking out against the government or calling for reform.

Know more about Russia’s political culture  here:

https://brainly.com/question/32422023

#SPJ11

Many credit Chicago's Maxwell Street Market as the birthplace of R&B. True/False

Answers

Many credit Chicago's Maxwell Street Market as the birthplace of R&B. -True

In Chicago, Illinois, slightly south of Roosevelt Road, Maxwell route, an east-west route, connects with Halsted Street. While Chicago's Maxwell Street Market is renowned for its thriving music scene and has an important history in overall development of blues music, it is also regarded as the origin of R&B also known as Rhythm and Blues.

R&B was created by fusing blues, jazz, gospel, and other musical genres. It mostly emerged in African-American communities in the time period of 1940s and 1950s. Several places, including New Orleans, Los Angeles, and New York, are where it first emerged. It is noteworthy for being the home of the renowned Maxwell Street Market, the origin of Chicago blues, and the 'Maxwell Street Polish', a sausage sandwich.

Read more about Maxwell Street on:

https://brainly.com/question/26678213

#SPJ4

why do you think stalin overturned the permissive social legislation that was enacted in the 1920’s?

Answers

Stalin overturned the permissive social legislation that was enacted in the 1920s because of Consolidation of Power, Ideological Shift, Social Engineering and Control, Collectivization and Industrialization and Political Purges and Control of Opposition.

Stalin's selection to overturn the permissive social regulation enacted within the 1920s within the Soviet Union can be attributed to several factors:

Consolidation of Power: Stalin aimed to consolidate his manipulation over the Soviet Union and solidify his role because of the leader. Reversing the permissive social rules allowed him to claim his authority and implement policies that aligned with his vision of a centralized, authoritarian country.

Ideological Shift: Stalin's management marked a shift toward an extra-conservative and orthodox interpretation of communism. The permissive social rules of the 20s, referred to as the New Economic Policy (NEP), allowed for sure elements of a marketplace economy and personal agency. Stalin, however, believed in a more centrally planned economy and rejected what he noticed as bourgeois impacts and capitalist inclinations associated with the NEP.

Social Engineering and Control: Stalin sought to exert more management over society and reshape it in line with his ideology. Overturning the permissive social regulation allowed him to impose strict country management over various components of lifestyles, inclusive of agriculture, industry, cultural expression, and person freedoms. It enabled him to get rid of perceived counter-modern factors and assert more manipulation over the populace.

Collectivization and Industrialization: Stalin's cognizance of speedy industrialization and collectivization required strict kingdom manage and vital planning. The permissive social rules of the 1920s, with its partial embrace of marketplace mechanisms and private organization, become visible as an impediment to reaching those dreams. Overturning this legislation allowed Stalin to pursue a more command-pushed financial system and prioritize the interests of the state over person freedoms.

Political Purges and Control of Opposition: Stalin's decision to reverse the permissive social regulation became additionally tied to his broader method of putting off perceived threats and consolidating his power. The dismantling of the NEP and the imposition of extra centralized manipulation helped him suppress competition and consolidate authority inside the Communist Party.

Overall, Stalin's decision to overturn the permissive social law of the 1920s can be seen as a strategic move to consolidate power, put into effect his imaginative and prescient of a centrally planned financial system, exert manipulation over society, and cast off perceived threats to his management. It represented a shift towards an extra authoritarian and ideologically rigid form of governance.

To know more  about Stalin,

https://brainly.com/question/27996725

#SPJ4

Declaration of Sentiments complaints:
1. Women had to obey laws created without their input.
2. Women could not attend college.
3. Married women were, for all intents and purposes, legally dead.
4. Women were not allowed to vote.
5. Women’s self-esteem was ruined due to their treatment at the hands of men.
6. Women had fewer rights than men with low morals and men who were not citizens.
7. Unmarried women were taxed with no say in how the money was to be spent.
8. Women could not be ministers, doctors, or lawyers. Women’s work was low-paying.
9. Women in divorce cases had no say over matters such as who would raise the children.
10. A married woman had no rights to property or the money she earned.
11. Men were given complete control over and responsibility for their wives.
12. Men were unrightfully "playing God" by deciding what was appropriate for women.
13. Because women could not vote, they could be more easily exploited.
14. Women were not allowed to hold important positions in the church or the state.
15. There was a different standard of behavior for men and women.
Questions:
1. Which complaint(s) would you consider the most serious?
2. Which complaint(s) most resemble complaints of colonists prior to the Revolutionary War?
3. Which complaint(s) relate more to entrenched attitudes about women than they do to legal obstacles to equality?
4. Which—if any—of the problems referred to in the complaints do you regard as still problematic today?
5. Which problem(s) referred to in the complaints, once solved, likely led to an improvement in society for everyone?

Answers

1. The most serious complaints would vary depending on individual perspectives, but some commonly highlighted complaints from the Declaration of Sentiments include:

Complaint 4: Women were not allowed to vote. This complaint represents a fundamental denial of a basic democratic right and political representation.Complaint 3: Married women were, for all intents and purposes, legally dead. This complaint reflects the severe lack of legal rights and agency married women had, being unable to own property, sign contracts, or have control over their own earnings.Complaint 10: A married woman had no rights to property or the money she earned. This complaint underscores the economic dependence and lack of financial autonomy that married women faced, putting them in vulnerable positions.

2. Complaints that are most similar to colonist grievances prior to the Revolutionary War:

Complaint 1: Women had to obey laws created without their input. This complaint resonates with the colonists' discontent about taxation without representation, highlighting the lack of influence and participation in decision-making processes.

3. Complaints that relate more to entrenched attitudes about women:

Complaint 5: Women's self-esteem was ruined due to their treatment at the hands of men. This complaint addresses societal attitudes and the mistreatment of women, reflecting deeply ingrained prejudices and biases.

4. Problems referred to in the complaints that are still problematic today:

Complaint 4: Women were not allowed to vote. Although significant progress has been made, gender disparities in political representation and the fight for equal voting rights continue to persist in various parts of the world.Complaint 10: A married woman had no rights to property or the money she earned. While legal protections have improved, economic inequality and gender-based financial disparities still exist, impacting women's economic empowerment.

5. Problems referred to in the complaints that led to an improvement in society for everyone:

Complaint 4: Women were not allowed to vote. Overcoming this obstacle and securing women's suffrage has led to greater inclusivity and democratic participation, benefiting society as a whole.Complaint 8: Women could not be ministers, doctors, or lawyers. Women's work was low-paying. Progress in breaking down gender barriers in professions and addressing wage disparities has contributed to a more diverse and equitable society.

It's important to note that these assessments are subjective and open to interpretation, and different individuals may have varying perspectives on the significance and impact of each complaint.

Learn more about Economic Empowerment:

https://brainly.com/question/29448275

#SPJ4

War has broken out. You must train your workers to become soldiers. Decode this secret message to unlock a tomb full of artillery. What is the message about? Fur red bath dare bowls oogles boomings ekphrasis sandstone

Answers

The message provided "Fur red bath dare bowls oogles boomings ekphrasis sandstone" is an example of a secret code. It is unclear exactly what the message is about, but it seems to relate to war and potentially finding weapons or artillery.

To decode the message, one would need to use a cipher or decoding method. Without more information on the specific method used to encode the message, it is impossible to determine what the decoded message would say.The prompt also mentions a scenario where workers need to be trained to become soldiers in a time of war.

In summary, the provided message is a secret code that needs to be decoded. The specific meaning of the message cannot be determined without decoding it. The prompt suggests that the message could potentially provide important information related to training workers to become soldiers or finding weapons during a time of war.

To know more about encode visit:

https://brainly.com/question/13963375

#SPJ11

The total number of slaves in the American colonies continually between 1620 and 1750. Over this period, the lives of slaves became. The majority of slaves in the colonies lived in the

Answers

The number of slaves in the American colonies constantly increased between 1620 and 1750. The most significant increase in slave numbers occurred after the introduction of the transatlantic slave trade.

The introduction of slavery in the colonies resulted in a significant shift in the lives of slaves. Slaves were forced to live in substandard conditions, working long hours, and experiencing extreme brutality and punishment if they disobeyed their owners.Slavery continued to be a vital part of the American economy, which resulted in the increase of the slave population.

Slaves worked on large plantations and provided the labor necessary for the success of the tobacco, cotton, and rice crops.In addition to agriculture, slaves worked in other industries such as shipping, mining, and lumber. Slaves were considered property and were bought and sold by their owners, which often resulted in families being separated. Despite the harsh living conditions, slaves were instrumental in building the American economy.

To know more about plantations visit:

https://brainly.com/question/28525425

#SPJ11

which issue did the u.s. supreme court address in plessy v. ferguson (1896) and brown v. board of education (1954)? responses separate-but-equal facilities separate-but-equal facilities one man, one vote one man, one vote equal pay for equal work equal pay for equal work racial quotas

Answers

The US Supreme Court addressed the issue of "separate-but-equal facilities" in Plessy v. Ferguson (1896) and Brown v. Board of Education (1954).

Plessy v. Ferguson was a Supreme Court case in 1896 that upheld the constitutionality of "separate but equal" facilities for Black Americans. In 1892, Homer Plessy, who was 1/8 Black and 7/8 White, challenged a Louisiana law that required separate train cars for Black and White passengers. He refused to sit in the Black car and was arrested. The Supreme Court ruled in favor of "separate but equal" facilities.What is Brown v. Board of Education Brown v. Board of Education was a landmark Supreme Court case in 1954 that declared that the "separate but equal" doctrine was unconstitutional in the context of public schools. The case involved several Black families who challenged the segregation of public schools in Topeka, Kansas. The Supreme Court ruled that "separate educational facilities are inherently unequal," and that segregation in public schools violated the Equal Protection Clause of the 14th Amendment.

To know more about segregation, visit ;

https://brainly.com/question/1574751

#SPJ11

Holiness, justice, love, goodness, truth, and mercy are all examples of the non-moral attributes of God. True
False.

Answers

False. Holiness, justice, love, goodness, truth, and mercy are all examples of the moral attributes of God. Moral attributes are traits that relate to the character and nature of God. They are qualities that show God's ethical character or those that portray God's character in relation to humans. In contrast, non-moral attributes are the qualities that describe the essence of God's being, character, and nature, which don't relate to morality.For example, the non-moral attributes of God are qualities such as omnipresence, omnipotence, and omniscience.

These attributes describe the nature of God and relate to God's power, presence, and knowledge. Non-moral attributes focus on who God is and what He can do, while moral attributes focus on how God acts toward humans and what God expects of them.

Know more about moral attributes of God here:

https://brainly.com/question/30553532

#SPJ11

HURRY PLEASE HELP IN THE NEXT FIVE MINUTES
Read the scenario.

Darcy is running for governor. She meets with a super PAC of educators, and they are impressed with her ideas for funding schools.

How could the super PAC support Darcy?
A) by financing a series of ads about her ideas
B) by raising money for her campaign
C) by giving her a large sum of money
D) by paying for her campaign’s travel expenses

Answers

A) by financing a series of ads about her ideas

The super PAC of educators can support Darcy by financing a series of ads about her ideas. This can help to improve her chances of winning the election by increasing her visibility and spreading information about her policies to a wider audience. By producing and airing ads, the super PAC can help to create a positive impression of Darcy's ideas in the minds of voters and build momentum for her campaign.

Why did martin luther king lead marches in the North

A. ) To point out the needs of the poor

B. ) To point out prosperity in the north

C. ) To point out the accomplishments of the rich

D. ) To point out problems in the south

Answers

The reason Martin Luther King Jr. led marches in the North was D. ) To point out problems in the south.

Why did Martin Luther King Jr. march in the north as well ?

Martin Luther King Jr. led marches in the North primarily to draw attention to and highlight the ongoing civil rights issues and injustices faced by African Americans in the southern states. While the Civil Rights Movement was primarily focused on combating racial segregation and discrimination in the southern United States, King recognized the importance of bringing national attention to these issues.

By organizing and leading marches in the North, King aimed to shed light on the systemic racism, inequality, and social injustices prevalent in the southern states, raising awareness among a wider audience and mobilizing support for the cause of civil rights.

Find out more on Martin Luther King marches at https://brainly.com/question/17049474

#SPJ1

Which goal was a reason for the formation of the Association of Southeast Asian Nations?


the elimination of national borders and the formation of a single united nation in Southeast Asia

the continued spread of communism among the nations of Southeast Asia

the promotion of trade among the nations of Southeast Asia and the Pacific Rim

the formation of a defensive alliance against future aggression from Japan

Answers

The formation of the Association of Southeast Asian Nations (ASEAN) was primarily driven by the goal of promoting regional cooperation and stability, particularly through economic integration and the strengthening of diplomatic ties among its member nations. Therefore, the most accurate option among the given choices is "the promotion of trade among the nations of Southeast Asia and the Pacific Rim."

ASEAN was established on August 8, 1967, by Indonesia, Malaysia, the Philippines, Singapore, and Thailand. Its formation was a response to the shared concerns and aspirations of these countries in the post-colonial era, including the desire for regional peace, stability, and economic development. The founding members recognized the importance of collaboration and mutual support to overcome challenges and exploit opportunities in the region.

One of ASEAN's primary objectives was to promote economic cooperation among member states. This involved reducing trade barriers, promoting investment, and fostering regional economic integration. Through initiatives such as the ASEAN Free Trade Area (AFTA), ASEAN has worked towards creating a single market and production base, facilitating the free flow of goods, services, and investments within the region. By promoting trade and economic cooperation, ASEAN aimed to enhance the economic development and prosperity of its member nations.

While addressing regional security concerns was also a key aspect of ASEAN's objectives, it was not solely focused on countering communism or forming a defensive alliance against Japan. Rather, ASEAN pursued a policy of neutrality and non-alignment, seeking to foster peaceful coexistence and constructive dialogue among nations. This approach aimed to prevent conflicts, resolve disputes diplomatically, and promote stability in the region.

Final answer:

In summary, the primary goal for the formation of ASEAN was the promotion of trade and economic cooperation among the nations of Southeast Asia. By fostering regional integration and collaboration, ASEAN aimed to enhance economic development, peace, and stability in the region, rather than eliminating borders, countering communism, or forming a defensive alliance against Japan.

For more questions on ASEAN

https://brainly.com/question/8664247

#SPJ8

What conflict started in 1860 when several southern states voted to secede, or
withdraw from the Union?

HELP!!!

Answers

Answer:

American Civil War

Explanation:

Secession, in U.S. history, the withdrawal of 11 slave states (states in which slaveholding was legal) from the Union during 1860–61 following the election of Abraham Lincoln as president. Secession precipitated the American Civil War

pls mark as brainliest!! and hope this helped you

often people who had just acquired wealth were educated without the classics and preferred short articles published in . next question

Answers

Often, people who had just acquired wealth were educated without the classics and preferred short articles published in contemporary magazines and newspapers.

In the context of individuals who recently obtained wealth, their education often lacked a focus on classical literature and instead prioritized consuming shorter articles found in contemporary magazines and newspapers. This preference can be attributed to various factors, including the time constraints faced by newly wealthy individuals who may be engrossed in managing their newfound wealth and engaging in social activities.

Additionally, the modern era's fast-paced society and the rise of mass media during this period catered to shorter attention spans, leading to a demand for concise and accessible information. Consequently, individuals sought out easily digestible content available in popular magazines and newspapers, which often contained current events, practical advice, entertainment news, and other topics of interest. This trend of favoring shorter articles over classical education among the newly affluent reflected the changing values and priorities of the time, emphasizing practical knowledge and immediate relevance in their pursuit of information.

For more questions on published

https://brainly.com/question/32206755

#SPJ8

Complete Question

often people who had just acquired wealth were educated without the classics and preferred short articles published in ______. Fill in the blanks.

Raising funds for war

Producing war supplies

Feeding U.S. troops in Europe

Conserving fuel for factories
that produce war supplies
l
I

Answers

The four actions above are significant efforts undertaken by the United States during World War II to support the war effort

What is Raising funds for war

During World War II, the U.S. raised funds for the war effort. Govt. used diverse tactics to gather funds. Encouraging citizens to purchase war bonds.

War bonds were loans for the government to fund military efforts and produce war supplies. During World War II, the United States increased industrial capacity to produce significant war supplies.

Learn more about Raising funds for war from

https://brainly.com/question/32167049

#SPJ1

despite the reports columbus gave ferdinand and isabella of finding great riches, he mostly foundtimber and and and hawk’s and glass beads.

Answers

Despite the reports Columbus gave Ferdinand and Isabella of finding great riches, he mostly found timber, wild plants, hawk’s bells, and glass beads.

Columbus is known to have embarked on four voyages to the Caribbean, Central, and South America with the aim of finding an alternative route to India that would enable Spanish trade with the East Indies. Columbus's voyage in 1492, which led him to the Caribbean, was made possible by Ferdinand and Isabella's sponsorship.

Columbus did not find great wealth in the Caribbean. He found a vast expanse of trees, which he cut down for timber. The land had wild plants, and hawk’s bells were found on birds. Columbus also found glass beads which he had brought from Spain to trade with the natives.

The voyages, in general, brought disease to the native people, exploitation of resources, and the beginning of the transatlantic slave trade.

Learn more about reports Columbus: brainly.com/question/28244659

#SPJ11

In 1803, the United States bought a large area of land from France. Which of the labeled locations on the map was most likely part of this sale?
a. Location A
b. Location B
c. Location C
d. Location D

Answers

In 1803, the United States bought a large area of land from France is best represented by location B on the given map.

Explanation: In 1803, the United States bought a vast region of land from France. This acquisition was known as the Louisiana Purchase, and it included the territory from the Mississippi River to the Rocky Mountains. As per the map, location B is located between the Mississippi River and the Rocky Mountains, and it is more likely part of the Louisiana Purchase. Hence, the correct option is b. Location B.

The Louisiana Purchase refers to the acquisition of a vast territory in North America by the United States from France in 1803. The purchase effectively doubled the size of the young United States and had significant implications for the nation's history.

The Mississippi River is one of the major rivers in North America, located in the United States. It is the second-longest river in the United States, flowing approximately 2,320 miles (3,730 kilometers) from its source at Lake Itasca in northern Minnesota to its mouth at the Gulf of Mexico.

To get more information about Louisiana Purchase visit:

https://brainly.com/question/28260361

#SPJ11

the reaction to the situation described in the third paragraph represented a continuity with which of the following earlier colonial developments? responses a strict racial system was established that separated enslaved people from european colonists. a strict racial system was established that separated enslaved people from european colonists. some enslaved native americans were incorporated into colonial society. some enslaved native americans were incorporated into colonial society. some colonists used enlightenment principles to argue for racial equality between europeans and africans. some colonists used enlightenment principles to argue for racial equality between europeans and africans. the institution of slavery was transferred to colonial america unaltered from west africa.

Answers

The reaction to the situation described in the third paragraph represented a continuity with the colonial development in which a strict racial system was established that separated enslaved people from European colonists.

Colonialism is a practice in which a country extends its authority over another nation or territory. The colonizing country is interested in gaining economic, political, and social control over the territory it is colonizing. In the US, slavery was a by-product of European colonialism.

Enslaved Africans were shipped to North America during the late sixteenth century and the seventeenth century to work on colonial plantations.

Colonial plantation slavery in North America has resulted in a strict racial system being established that separated enslaved people from European colonists and established the notion that white people are superior and black people are inferior.

In conclusion, the reaction to the situation described in the third paragraph represented a continuity with the colonial development in which a strict racial system was established that separated enslaved people from European colonists.

Learn more about colonial development: brainly.com/question/2487293


#SPJ11

which of the achievements above do you think united abbasid society the most? explain.

Answers

The establishment and development of a robust administrative and bureaucratic system played a crucial role in uniting Abbasid society.

What is the achievement?

One of the accomplishments of the Abbasid Caliphate was the creation and growth of a strong administrative and bureaucratic apparatus, which was essential in bringing Abbasid society together. Based on the effective operation of several institutions, this administrative structure promoted cohesion and stability within the empire.

The Abbasid Caliphate established a complex administrative system that included, among other things, the Diwan al-Kharaj (Department of Finances), Diwan al-Barid (Department of Postal Service), Diwan al-Qudat (Department of Justice), and Diwan al-Jund (Department of Military Affairs).

Learn more about achievement:https://brainly.com/question/10435191

#SPJ4

Which areas of the empire were not threatened by invaders?

(Invasions into the Roman Empire, 350-500 AD)

Answers

Between the years 350-500 AD, the Roman Empire experienced invasions from various regions. However, some areas within the empire were not threatened by the invaders.

These areas were mainly the Eastern parts of the Roman Empire, including Anatolia, Palestine, and Egypt. This is due to the fact that the Eastern part of the empire was well protected by the border walls, and the Byzantine army was well equipped and prepared for any potential invasion.

Additionally, Palestine, which is present-day Israel, and Egypt were protected by the desert, making it difficult for any invaders to penetrate the region. Furthermore, Egypt was home to the Eastern Roman Navy, which was one of the most powerful navies in the world at that time. Therefore, the invaders could not penetrate the region due to the naval superiority of the Eastern Roman Empire.

To know more about penetrate visit:

https://brainly.com/question/29829511

#SPJ11

what was significant about the gubernatorial election of 1946?

Answers

The gubernatorial election of 1946 was significant because it marked the first time in over 30 years that Republicans gained control of Congress. What was the outcome of the gubernatorial election of 1946?The gubernatorial election of 1946 was significant for several reasons. It was the first election following the end of World War II, and it marked the beginning of a period of conservative dominance in American politics.

This shift was most evident in Congress, where Republicans gained control of both the Senate and the House of Representatives for the first time in over 30 years. Republicans captured 55 seats in the Senate and 246 seats in the House of Representatives.

Know more about gubernatorial election of 1946 here:

https://brainly.com/question/11783982

#SPJ11

Francis Bacon,Lucien Freudand and Jean Dubuttet.

For each of the above three artists - list a piece of work. Give the title, date, medium
Describe each piece of art by each artist. What do you see? (5 sentence minimum)
What is the historical significance of this piece of art - what does it represent? What is it about, what is the meaning of the piece of art? (5 sentence minimum)

Answers

Francis Bacon, Lucien Freud, and Jean Dubuttet were the artists who played significant roles in the art industry. They had created several iconic pieces of art.

Here's a list of the art pieces created by them and their historical significance:

Francis Bacon's 'Three Studies for Figures at the Base of a Crucifixion' (1944):This piece of art has three distorted, screaming, and tortured figures that seem to depict the horrors of the Holocaust. It symbolizes the fear and anxiety that humans had faced during World War II. Bacon had painted this piece in 1944, and it's a perfect example of post-war art. Bacon had wanted to portray a sense of deep existential horror that was felt during the war.

Lucien Freud's 'Girl with a White Dog' (1950-51):Lucien Freud was a British painter who was famous for his realistic paintings. This painting was painted in 1950-51. It's a portrait of a woman who is holding a small white dog in her lap. The girl looks away, and her expression is pensive. The painting is an illustration of Freud's fascination with the human form, particularly in the way it ages. The girl seems to be in her middle age, and she seems to be experiencing a sense of melancholy.

Jean Dubuttet's 'Paysage Aux Arques' (1973):This painting by Dubuttet features bright colors and an abstract landscape. The painting was created in 1973 and is a part of Dubuttet's 'L'Hourloupe' series. Dubuttet had created this painting after he had returned from a trip to the village of Les Arques. He was inspired by the colors and shapes that he had seen on the journey. The painting represents the artist's vision of the world, which is chaotic, frenzied, and full of color.

Learn more about Francis Bacon at https://brainly.com/question/910080

#SPJ11

by the end of the war of 1812, industry—particularly ______—had experienced dramatic growth.

Answers

Answer: textiles

Explanation: i did my research and  textiles made the more sense in the sentence so i can guess it was textiles

By the end of the War of 1812, industry—particularly manufacturing—had experienced dramatic growth.

The conflict, fought between the United States and the British Empire, had significant repercussions for American industry. The war disrupted trade between the two nations, leading to a decline in imports and forcing the United States to develop its own manufacturing capabilities.

During the war, the British blockaded American ports, cutting off access to foreign goods. This compelled the United States to establish domestic industries to meet the demands of its population. American manufacturing flourished, with industries such as textiles, ironworks, and machinery experiencing rapid expansion.

The war also spurred technological innovation and infrastructure development. The need for efficient transportation of goods and military supplies led to the construction of roads, canals, and railroads, which further facilitated industrial growth. The war encouraged the invention of new machinery and manufacturing techniques, contributing to increased productivity and output.

The growth of industry during and after the War of 1812 laid the foundation for the United States to emerge as a leading industrial power in the following decades. It marked a significant shift towards self-sufficiency and economic independence, setting the stage for the Industrial Revolution in the country.

Learn more about manufacturing here:

https://brainly.com/question/28286736

#SPJ4

a) briefly describe one perspective about women’s roles during the 1920s expressed through the image. fisk tires

Answers

The Fisk Tires image from the 1920s displays the perspective of girls' converting roles all through that era. The image depicts a girl hopefully riding a vehicle while a male passenger sits beside her. This photograph represents a growing recognition of ladies' independence and freedom for the duration of the 20s, mainly with regard to transportation and mobility.

The photo may be visible as a symbol of the evolving function of girls in society, as it demands situations of conventional gender norms that restricted girls typically to the home sphere. It portrays ladies as capable and self-reliant, highlighting their ability to navigate and control a generation previously associated with male dominance.

By showcasing a female riding, the photo shows a shift in societal attitudes in the direction of girl empowerment and the growing presence of women in public spaces. It indicates a departure from the restrictive gender roles of the beyond and implies an experience of liberation and autonomy for ladies at some stage in the 1920s.

Overall, the Fisk Tires photo captures an attitude that recognizes and celebrates the expanding roles and freedoms of ladies in the 1920s, especially concerning their capacity to take part in activities historically associated with guys, which includes driving and automobile exploration.

To know more about women's rights,

https://brainly.com/question/29889363

#SPJ4

The correct question is:

"Briefly describe one perspective about women’s roles during the 1920s expressed through the image of Fisk Tires"



All of the following cities were major centers of trade during the Colonial Period, EXCEPT

A. Boston, Massachusetts.

B. Philadelphia, Pennsylvania.

C. New York, New York.

D. Richmond, Virginia.

Answers

During the Colonial Period, major centers of trade included Boston, Massachusetts, Philadelphia, Pennsylvania, New York, New York, and Richmond, Virginia. In reality, all four cities mentioned above were major centers of trade during the colonial period.

The colonial period refers to the 1600s and 1700s in America, when colonists from Europe began to settle in North America, leading to a period of significant development and growth in the region.As they developed, these four cities became major trading hubs, serving as points of departure and arrival for goods coming from all over the world.

New York was known for its financial and trade centers, while Richmond was a hub for tobacco and other agricultural products.As a result of their trade activities, these four cities grew rapidly, with many merchants and tradespeople becoming wealthy from their dealings. Today, they continue to be important economic centers in the United States and around the world.

To know more about development visit:

https://brainly.com/question/29659448

#SPJ11

when gandhi was elected president of the indian national congress party in 1921, he preached what to the indian people?

Answers

Gandhi's preachings to the Indian people after his election to the president of the Indian National Congress Party in 1921, focused around ahimsa, or non-violence.

He encouraged the Indian people to stand up against the British colonial rule in a peaceful and constructive fashion, and to actively resist oppression through self-sufficiency, non-violence, and an insistence on justice. He argued that the change should come from within and without taking physical action, the individual can motivate and set an example for the entire nation to follow.

He also spoke about developing a sense of collective support, mutual understanding and communal harmony as well as social cohesion among Indians. He urged people to reject any differences based on religion, caste or class. He also emphasised of the need of complete independence from the British. Above all, he talked of forgiveness in order to establish peace and harmony in the country.

To know more about Gandhi , click here:

https://brainly.com/question/7432909

#SPJ4

14 The empirical relationship that determines total solidification time in casting is known as which one of the following: (a) Bernoulli's theorem, (b) Chvorinov's rule, (c) continuity law, (d) flow curve, (e) Hooke's law, or (f) Ohm's law?

Answers

The empirical relationship that determines total solidification time in casting is known as Chvorinov's rule .

What is Chvorinov's rule? Chvorinov's rule is used to calculate the total solidification time of a casting. It is defined as the ratio of the volume of the casting to the surface area of the casting. The surface area of the casting is related to the amount of heat that must be removed from the casting, and the volume of the casting is related to the amount of heat that must be transferred through the casting in order to solidify it completely Chvorinov's rule states that the total solidification time is proportional to the square of the casting's thickness and inversely proportional to the surface area-to-volume ratio.

An empirical relationship refers to a relationship or correlation observed or derived from empirical evidence or observations. It is based on real-world data or observations rather than on theoretical assumptions. In other words, it is a relationship that has been observed through experimentation, measurement, or observation, rather than being derived from a theoretical or mathematical model.

To get more information about Chvorinov's rule visit:

https://brainly.com/question/29990888

#SPJ11

the hunger games is a science fiction adventure film based on the novel of the same name by suzanne collins.

Answers

The Hunger Games is a science fiction adventure film based on the novel of the same name by Suzanne Collins.

It tells the story of a dystopian society where children from different districts are forced to compete in a televised battle to the death called the Hunger Games as a way for the government to maintain control and prevent uprisings.

The main character, Katniss Everdeen, volunteers as tribute to take the place of her younger sister and fights for survival against other skilled and deadly tributes. The film explores themes of power, oppression, sacrifice, and rebellion. It stars Jennifer Lawrence as Katniss Everdeen and is directed by Gary Ross.

The Hunger Games was a critical and commercial success, leading to three sequels and a franchise that has become a cultural phenomenon.

To learn more about adventure, refer below:

https://brainly.com/question/28715373

#SPJ11

Other Questions
SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy. The dataset catsM is found within the boot package, and contains variables for both body weight and heart weight for male cats. Suppose we want to estimate the popula- tion mean heart weight (Hwt) for male cats. We only have a single sample here, but we can generate additional samples through the bootstrap method. (a) Create a histogram that shows the distribution of the "Hwt" variable. (b) Using the boot package, generate an object containing R=2500 bootstrap samples, using the sample mean as your statistic. 8 class monitors march and hoist the school flag on a Monday. They walk in a line so that every monitor except the first is preceded by another. On Tuesday, to avoid everyone seeing the same person immediately in front of them, they decide to switch positions so that no monitor is preceded by the same person who preceded him on Monday. In how many ways can they switch positions to satisfy this condition? richard walks at 5.0 mph on three days per week. on each day that he walks at 5.0 mph, he walks for 30 minutes. after each walk, richard consumes approximately 200 calories of fruits and vegetables. how many met minutes per week does richard spend walking at 5 mph? The current ratio is measured by Current assets / Current liabilities. Assume this ratio is greater than 100% (or 1:1) and that the cash balance remains positive at all times. State the effect the fol Blue Wave Co. predicts the following unit sales for the coming four months: September, 3,900 units, October, 4,500 units, November. 6,100 units; and December, 8,000 units. The company's policy is to m Example Given the supply function P=10+ vg Find the price elasticity of supply. (a) Averaged along an arc between Q=100 and Q=105 (b) At the point Q=100. The following data were collected from a sample of fathers and sons. The heights are given in inches. Construct a 95% confidence interval for the slope of the regression line. Round your answers to two decimal places, if necessary.Heights of Fathers and Sons (in Inches)Height of Father, x: 65, 67, 66, 71, 65, 70, 73, 71, 69Height of Son, y: 69, 67, 68, 73, 65, 73, 76, 73, 70 All of the following can be used to evaluate continued infertility with a normal sperm count exceptA. Semen fructose levelB. Eosin-nigrosin stainC. Plasma and semen agglutinationD. Immunobead test Find the critical t-value that corresponds to 50% confidence. Assume 23 degrees of freedom.