What value does Macbeth place on the following? Cite specific details from the drama to support your conclusion.

Answers

Answer 1

King Duncan of Scotland's general of battle, Macbeth, was highly regarded in the court for his combat prowess: "SCENE II. A camp near Forres.

What is the concept of the excerpt?

Three witches unexpectedly arrive when Macbeth and his friend Banquo return from a victory, telling them that Macbeth will become Thane of Cawdor and king of Scotland, and Banquo's descendants will take the crown. As the witches vanish into thin air, the two characters consider the prescience of the supernatural force.

Unexpectedly, he receives word from a king's emissary that he has been appointed as Cawdor's Thane, fulfilling one of the witches' prophecies.

Thus, King Duncan of Scotland's general of battle, Macbeth.

For more information about concept of the excerpt, click here:

https://brainly.com/question/11417929

#SPJ1


Related Questions

PLEASE HELP ME ASAP!
NO LINKS PLEASE!!!
(the immortal life of Henrietta locks)
The author uses several analogies in paragraphs 10-16 to describe cells. Which one is NOT used in the text?

Question 10 options:

A)

fried eggs


B)

bees in a hive


C)

workhorse


D)

choreographed dance

Answers

Answer:

A). Fried eggs

Explanation:

Answer: Bees in a hive

Explanation: B

Please Help!
__________
Rule :
- Don't answer Origin
- Answer correctly​​​

Answers

Answer:

clocks ..

Explanation:

what are some benefits of doing cold connections versus soldering metal together?

jewelry class​

Answers

Answer:

Advantages of Soldering

Lower Heat. Soldering requires temperatures around 400°F

Does Not Warp. Since solder flows at lower temperatures, the metals connected do not melt or warp

Solder Conducts Electricity. The solder flows between the electrical connectors to bond them together

Multiple Connections

Easy-to-Learn.

Advantages of soldering

Low power is required

Low process temperature

No thermal distortions and residual stresses in the joint parts

Microstructure is not affected by heat

Easily automated process

Dissimilar materials may be joined

High variety of materials may be joined

Explanation:

you can do it champ, if this helped you, please give brainlest

1 to 10 how good does my dog look healthy​

Answers

Answer:

I would say about an 9.5.

Explanation:

He’s looks really health, not sure if this was helpful but I hope this helped.

Have an AMAZING day.

Answer:

Omg! Adorable!

Explanation:

AND A 10!!

Read the passage

excerpt from "First Love"
Judith Ortiz Cofer

The lights had been turned off in the hallway and all I could see
was the lighted stairwell, at the bottom of which a nun would be
stationed. My father would be waiting just outside. I nearly
screamed when I felt someone grab me by the waist. But my
mouth was quickly covered by someone else's mouth. I was
being kissed. My first kiss and I could not even tell who it was. I
pulled away to see that face not two inches away from mine. It
was he. He smiled down at me. Did I have a silly expression on
my face? My glasses felt crooked on my nose. I was unable to
move or to speak. More gently, he lifted my chin and touched his
lips to mine. This time I did not forget to enjoy it. Then, like the
phantom lover he was, he walked away into the darkened
corridor and disappeared

Refer to Explorations in Literature for a complete version of this
narrative


How does Cofer shape the theme that people don't always get
what they want with this passage?

She shares details that include her "father would be
waiting just outside."

She includes details about her first kiss that include
o the fact she "could not even tell who" she was
kissing

She describes the object of her affection who gave
her her first kiss as a "phantom lover."

She explains how just as quickly as she was kissed,
"he walked away into the darkened corridor and
disappeared

Answers

Answer: She explains how just as quickly as she was kissed, "he walked away into the darkened corridor and disappeared"

The correct option is She explains how just as quickly as she was kissed, "he walked away into the darkened corridor and disappeared.

What is first love by Judith Ortiz Cofer?

The fundamental theme of "First Love," a short story by Judith Ortiz Cofer, which shows how love affects the protagonist's life, is love in all of its manifestations.

In The primary character is a 14-year-old Puerto Rican girl who has a serious crush on the Italian senior boy in her class who comes from a wealthy household.

The girl is so fixated on the boy that she goes out of her way repeatedly to catch his eye and show up in the same place as him. The girl frequently attempts to visit this store to meet the lad since she refers to him as her "love," sometimes even when it's raining.

Therefore, The correct option is She explains how just as quickly as she was kissed, "he walked away into the darkened corridor and disappeared.

To learn more about Judith Ortiz Cofer refer to the link:

https://brainly.com/question/10893780

#SPJ2

Please write 4-5 sentences about what you see in this image.

Answers

A Elephant that has trandinally clothes the elephant looks sad it lookes like he is getting forced to do that

If a poet calls you her muse, then you

Answers

Answer: if a poet calls you her muse that means that they are calling you beautiful

Explanation:

Two wires dangled from the heart of the machine and gently danced in the breeze. I knotted their frayed ends together with the wires that sprouted off the reed, just as I’d always pictured. Down below, the crowd cackled like a gang of birds. “Quiet down,” someone said. “Let’s see how crazy this boy really is.” —The Boy Who Harnessed the Wind, William Kamkwamba

What idea does this middle section help to develop?
Building the windmill involved the whole community.
The author did not understand the technical requirements of building a windmill.
No one believed that the boy could build a windmill.
It was a nice breezy day when the boy first operated the windmill.

Answers

Answer:

C, No one believed that the boy could build a windmill.

Explanation:

I did it on edge.

Read the excerpt from Does My Head Look Big in This? by Randa Abdel-Fattah. Which phrases from the excerpt best support the narrator’s confident tone? Select three options.

Answers

Answer:"head held high" "smile to yourself" "special bond".

Explanation:

PLS HELP

Read the excerpt from Holes.

Now Stanley tried to pretend he was going to Camp Fun and Games. Maybe he'd make some friends, he thought. At least he'd get to swim in the lake.

What does this description tell you about Stanley’s character?

He tries hard to be positive about unfortunate situations.
He lies to himself because he is unable to face his reality.
He focuses often on making friends because he has none.
He feels sorry for himself and wishes he had a better life.

Answers

Answer:

He tries hard to be positive about unfortunate situations

Answer:

it is a

Explanation:

i did thatv test

Analyze the ADVERBIAL INFINITIVES modify in the picture above​

Answers

Answer:

Explanation:Analyze the ADVERBIAL INFINITIVES modify in the picture above​

Please help, due by the end of the day!

What does this quote mean?
I've missed more than 9000 shots in my career. I've lost almost 300 games. 26 times, I've been trusted to take the game winning shot and missed. I've failed over and over and over again in my life. And that is why I succeed. -Michael Jordan

Answers

Answer:

This quote means trying again will get you success.

Explanation:

By taking these risks and failing he's learning what to do to then improve his game and succeed.

Answer: What i got from that was not everyone is good at the one thing they love to do so here is a example i have to make a painting for musams 1,000 times but i failed. I've been givin 100 trys scaltrue for the most famos person on earth and i was trusted but i failed. and even thought i failed every mistake i can make i'm just learning at the same time.

Explanation:

please anyone who knows…..

Answers

Answer:

...the mammoth weighs more than the t-rex. The whale weighs the most out of all the animals though. The fast animal is the t-rex. The second fastest is the mammoth and then the whale.

What is the meaning of MEANEST​

Answers

Answer:

unwilling to give or share things, especially money; not generous.

Explanation:

what are physicochemical materials?

Answers

Physico-chemical properties are the intrinsic physical and chemical characteristics of a substance. These include appearance, boiling point, density, volatility, water solubility and flammability etc.

Where do teenagers get all the money they need to make purchases? I noticed several new stores had opened up at the local mall. Most of these new stores focused on teenage and young consumers. Yesterday I went shopping. This paragraph is a. Creative c. 1 inch spaced b. Single-spaced d. None of these.

Answers

Based on the content and structure of the paragraph given, the paragraph is none of the above

The paragraph given is not:

Creative as it is not about one idea given that it talks about several issues such as teenagers getting money and new stores opening 1 inch spaced or Single-spaced as the paragraph is quite separated

The paragraph given is therefore not creative or spaced in a 1 inch or single form.

We can conclude by saying the paragraph is none of the options.

Find out more at https://brainly.com/question/19534533.

Answer:

D. none of these

Explanation:

1. I don’t mind ________ the poor. A. help B. helped C. helping D. to help

Answers

Answer:

C

Explanation:

Because it is in 5he present tense so it is C

how old is ms wanda from love and marriage huntsville

Answers

Answer:

She is 26 years old

Ms. Wanda is 26 years old in love and marriage: Huntsville.

What is Love and marriage: Huntsville?

Love and marriage: Huntsville is a TV show that came in 2019.

In the show, three African American couples come together to help Huntsville.

Thus, Ms. Wanda is 26 years old in love and marriage: Huntsville.

Learn more about Love and marriage: Huntsville

https://brainly.com/question/9375679




Choose the underlined part that needs correcting in each sentence below.



The puppets are maked of wood and then painted .

Answers

The correct sentence is, The puppets are made of wood and then painted.

The Starry Night
by A. Gautam

CHARACTERS:
SAMUEL, A middle-aged professor who looks like he has been teaching for centuries
NAGEN, A well-dressed boy who looks nervous and lost
VENUS, An antsy-looking girl dressed in a baseball cap and a torn shirt that looks new
RITCHIE, A dreamy looking young boy with ruffled hair

Stage Set: The outside of a museum. Samuel is leaning on a tree. The students are seated on the grass.

SAMUEL: Well, what was Van Gogh trying to say, really?
VENUS: I thought this was supposed to be a fun trip. You are—like—teaching us outside of class. What's up with that?
NAGEN: If I may, which painting were you referring to, sir?
SAMUEL: Starry Night. The waves in the sky. Imagination and reality. Darn, I am tired as the starry night.
VENUS: There he goes again, into his own little world. Do any of you know when the bus is supposed to pick us up?
NAGEN: I believe it is supposed to come at five. May I ask you a question, miss?
VENUS: Call me Ven. Waiting for the bus will be as fun as the dentist pulling my teeth out.
NAGEN: Ok, Ven. Why didn't the other students come with us?
VENUS: It was optional, dude!
RITCHIE: Nobody cares about art anymore. (to Nagen) Why did you come?
NAGEN: I need to keep busy after school. That is when, Richard, I get the most homesick.
RITCHIE: Call me Ritchie. Where is home for you?
SAMUEL: Who knows really what home is? Why can't people feel at home in art? Why the rush to belong? It does not make a difference if it is a stroke on the canvas or the work of clouds in the sky. To imagine is more important. To imagine the possibilities of the meaning is more beautiful. To find a home in the whole world is possible.
VENUS: Here comes the bus!
NAGEN: It's ————
(All rush to the bus.)



VENUS: Call me Ven. Waiting for the bus will be as fun as the dentist pulling my teeth out.


Which dramatic element is used in the lines above?
A.
dramatic irony
B.
verbal irony
C.
denouement
D.
climax

Answers

Answer:

verbal  irony

Explanation:

Verbal irony is a figure of speech. The speaker intends to be understood as meaning something that contrasts with the literal or usual meaning of what he says.

11. Discuss as a group the different aspects of being American. Then write a definition of the term
American. You may wish to consult your vocabulary tree from Activity 1.9 to help you compose
your definition. Include details from the essay to support your definition.

Answers

Answer:

povertyProcured:gainedMotives:reasonsMetamorphosis:change1In this great American asylum, the poor of Europe have by some meansmet together, and in consequence of various causes; to what purpose, should they ask oneanother, what countrymen they are? Alas, two thirds of them had no country. Can awretch who wanders about, who works and starves, whose life is a continual scene ofsore affliction or pinchingpenury; can that man call England or any other kingdom hiscountry? A country that had no bread for him, whose fieldsprocuredhim no harvest,who met with nothing but the frowns of the rich, the severity of the laws, with jails andpunishments; who owned not a single foot of the extensive surface of this planet? No!Urged by a variety ofmotives, here they came. Everything has tended to regeneratethem; new laws, a new mode of living, a new social system; here they are becomemen: in Europe they were as so many useless plants, wanting vegetative mould, andrefreshing showers; they withered, and were mowed down by want, hunger,

An individual who is bilingual is able to speak two different languages. Please select the best answer from the choices provided T F.

Answers

A bilingual individual is a person who is able to speak two different languages.

Another term that can be used to describe a person who can speak two different languages is bilinguist. This means when a person is capable of speaking two languages such as French and Spanish, Spanish and Chinese, Chinese and french etc.

The benefits of a bilinguist are:

Ability to speak two different languages

Ability to understand two different languages when spoken

Ability to translate two languages

Therefore, it is true that a bilingual individual is an individual who speaks two different languages.

Learn more about bilingual:

https://brainly.com/question/6987436

Answer:

True

Explanation:

E2023

PLEASE HELP ME URGENT
NO LINKS PLEASE!!!!!!!!
What mainly does the following passage reveal (paragraph 10)?

“And instead of being sad and unhappy they began to laugh and sing.”
Question 6 options:

A)

Jupiter became generous and allowed men to use fire to make their lives comfortable.


B)

Men realized they had more control of their lives than the gods had, and the men were happy.


C)

Men decided to be joyous even though Jupiter forbade them to have fire.


D)

Prometheus changed the lives of men for the better by giving them fire to use.

Answers

Answer:B. Prometheus changed the lives of men for the better by giving them fire

Explanation:

Took the test

What theme in the novel does Melville allude to with his use of the word “vindictive” to describe the movement of the ship in this excerpt?
inequality
rebirth
ignorance
revenge

Answers

Answer:

revenge

Explanation:

“vindictive” is used to describe revenge

what is all the symbols of the drummer boy of shiloh

Answers

Answer: peach stones peach blossoms and the general's wisdom.

Answer:

peach stones, peach blossoms, and the general's wisdom.

Explanation:

Hope this helps

MAy I get braineist pls??????????????????????

Plz help!!! i rlly need help :(

STORY: The Winter Hibiscus

questions are below! best responses will be marked as BRAINLIEST!!! :D

1. What does the Winter Hibiscus symbolize? Use examples from the text to support your response. *

2. When discussing literature, the term "dynamic character" means simply a character who undergoes some important change in the course of the story. Who is a dynamic character in "The Winter Hibiscus"? Why should this character be considered 'dynamic'? Provide evidence/examples from the beginning and the end of the story to support your response. *

3. What is the theme of the short story "The Winter Hibiscus"? What example(s) and/or event(s) from the text prove this? *

4. Based on her experiences in the story, what is the most difficult conflict that Saeng must face? (You can choose any of her internal conflicts or either of her external conflicts: Saeng vs. her mother, Saeng vs. her new environment in the United States) Use examples/evidence from the text to support your ideas. *

5. Using the list of generational conflicts on the whiteboard in the front of the classroom, what is the most dominate generational conflict in "The Winter Hibiscus?" Explain your ideas using examples from the text. *

Answers

The story, Winter Hibiscus is a very attention grabbing and perhaps a very beautiful one too. Thes story's main point or summary is a little mysterious in some ways. The plot Mountain goes like this

Rising Action: Saeng Failed the test and she is very mad at herself for failing

Rising Action: David (I can infer that Saeng likes him) looks like he already has someone to hang out with

Rising Actions are usually parts/events of the story that make the "problem worse". It is conflict that Characters face before everything is resolved the end.

There are many Conflicts that are mentioned, and some are

what I Infer about. In the part when she had taken the Car License test, you see that she is stressing out a lot. I could infer that she in having little conflicts with herself about If she's going to fail or not. Little did she know, these little conflicts turned out to be "BIG PROBLEMS" that she must face. She ends up not stopping at the Stop sign because she was worried and had little fights within her body. In which, we could turn to the Climax as she fails the License Test. During this part, the theme has not showed yet or to be made "Clearer"

Towards the falling action the story and the theme start to enroll in a way. When Saeng bought the winter Hibiscus it felt like a symbol of Hope. The texts from the book say that she planted the Winter Hibiscus, which comforts her in a way. It just comforts her.

Saeng is in fact a dynamic character I would say. In the rising action part, she was very mad at herself for failing. She does not do really anything about it. Instead, she is like "Eh, who cares", "It's just some weird test". Though, towards the end, the story made me feel like she has a little hope with her new life in America

I hope this helped

I know it's due soon

Read it at morning at give me some suggestions!

(: Sorry, this took too long....... I hope you don't mind.

"Jack had a knack for packing picnic baskets with great food."

Answers

Answer:

Definition of knack: An acquired or natural skill at performing a task.

Example:

"she got the knack of it in the end"

Answer:

Alliteration and assonance

Explanation:

these are both expressed in the sentence

which is most likely to slow down the pacing of a story?

Answers

Answer:

unneeded words

lots of speech

Explanation:

Wh
Eyou I do? I'm an electrician
Look at this sentence. What
this word / mean?
1 Davidiselt very fit. He
not do any soort
ftare me an hour to you to work in the moming how long,
the you?
1 Complete the sentences using these verbs. Sometimes you need the negative.
believe eat flow
80 grow mare rise tell translate
The can go found the sun
An interpreter
2 daeon't grow in cold climates
from one language into another
the sun
in the east
8 Liars are people who
honey
Vegetarian
mcat
The ver moon
in God
into the Auantic Ocean
2* You ask usa questions about herself and her family, Write the questions,
1 You know that is plays tennis. You want to know how often. Isk her.
How often do you play tennis ?
2 Pemaps assister plays tenors too. You want to know. Ask lisa
Yo now thalsa goes to the cinema a lou. You want to mnou how often Askhet

Answers

Answer:

(2.2)

2. what time does the Bank close here?

3. I have a car., but I don't use it much

4. where does Maria come from? Is she Spanish?

5. "what do you do?" ' I'm an electrician'

6. look at this sentence . what does this word mean?

7. David isn't very fit. He doesn't do any sports.

8. It takes me an hour to get to work. How long does it take you?

(2.3)

3. The sun rises in the east.

4. Bees make honey.

5. Vegetarians don't eat meat.

6. An atheist doesn't believe in God.

7. An interpreter translates one language into another.

8. Liars are people who don't tell the truth.

9. The river amazon flows into the Atlantic ocean.

(2.4)

2. Does your sister pay tennis as well?

3. How often do you go to the cinema?

4. What does your brother do?

5. Do you speak Spanish?

6. Where do your grandparents live?

hope this helps☆☆☆

Tryouts Kayla tried to ignore her sore throat and stuffy nose. She was trying out for the soccer team, and Coach Markham would pick only the twenty best players. Kayla sipped from her water bottle while she waited to do practice drills. She sneezed, and then Coach Markham signaled her to start. First, Kayla had to run across the field as fast as she could. She took off, but her stuffy nose made it hard to breathe. When she reached the end of the field, she felt dizzy and her head was swimming a little. She hoped the coach hadn't noticed. Next, she and another girl had to compete for control of the soccer ball. The other girl quickly stole the ball from Kayla. Kayla was surprised. She was usually good at this. For the first time, she worried that she might not make the team. Kayla struggled through the other drills, too. At the end of the tryout, she felt terrible and left as soon as she could. A few days later, Kayla had recovered from her cold. She was still worried about her performance at the tryout, but maybe it wasn't too late to do something about it. Kayla went to see Coach Markham. She explained that she hadn't done her best because of her cold. Coach Markham listened patiently and agreed to let Kayla join the team for the first practice. That was all Kayla wanted. She knew she would be a valuable member of the team. She just needed a chance to prove it. Which of the following best describes the main theme or lesson of the story?

a. Sometimes it pays to ask someone for a second chance.
b. Nothing is easy when you are sick
c. Never give up
d. No one likes to hear excuses

Answers

Answer:

A.

Explanation:

A. because she asked for another chance to her coach

also becaused i looked at my answers and your answers and the only one it had in common was A.

hope this helps...

The main theme or lesson of the story is best described as  Sometimes it pays to ask someone for a second chance. Thus the correct option is A.

What is a Theme?

The theme of a story highlights the storyline on which the story is based. These theme helps to determine the plot of the story as well as the events that are going to take place.

The passage entails the summary as Tryouts Kayla made an effort to ignore her stuffy nose and painful throat. She was trying out for the soccer team, and only the top twenty players would be chosen by Coach Markham.

The story concluded as Kayla recovered from her cold a few days later. She was still concerned about how she had performed at the audition, but maybe there was still time to make changes. She was confident that she would add much to the team. She only required a chance to demonstrate it.

Therefore, option A is appropriate.

Learn more about the theme, here:

https://brainly.com/question/11108997

#SPJ2

Other Questions
which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please