what is a building ​

Answers

Answer 1

Answer:

A building is any kind of structure that is mainly built with materials and is standing still

Explanation:

A building can be regarded as any kind of structure that is or was mainly built with materials and is standing in the ground. The materials can vary, such as sand, cement, iron, wood etc . A building also has different components, some of which includes Chimney, roof, decking, wall, floor etc.

There are different types of buildings, notably among them are

Residential building

Educational building

Institutional building and even

Assembly building.

Each of the above mentioned types of buildings differ from the other from little to a lot of differences.

Usually, an engineer is the one in charge of building a building


Related Questions

What is the preposition in this sentence.
The female chickens return and provide food for the little chicks.

Answers

Answer:

for

Explanation:

Quilling is the art of using paper strips to create decorative patterns. The final product of quilling is attractive and can be used to decorate homes, offices, and other places. People also use quilling to make jewelry and stylish picture frames. One can use colored or white strips of paper for quilling. Some choose to use thick paper, while some prefer thin paper for quilling designs. People often use craft paper or construction paper for quilling. The beauty of this art is that it can be created using very simple tools. Quilling supplies are found in most arts and crafts stores. Although quilling is fairly simple, many people choose to take courses to learn the different techniques of quilling. Quilling will interest everyone.
8
Read the sentence from the passage.

Quilling will interest everyone.

How could the sentence be changed to better conclude the passage?
A.
Therefore, the art of quilling will interest those who want to use their artistic touch and make their surroundings more beautiful.
B.
Therefore, people must read articles about quilling to remain updated about new quilling techniques.
C.
In recent times, the art of quilling has become popular amongst artists, youngsters, and homemakers.
D.
In recent times, decorative objects made by quilling have become a popular choice among customers in gift shop

Answers

Answer:

A.

Therefore, the art of quilling will interest those who want to use their artistic touch and make their surroundings more beautiful.

Explanation:

I think the answer is A because its a wrap-up of everything written in the paragraph, which makes it a good conclusion. It summarizes what was in the paragraph while making a final point on quilling.

When you are feeling down, what are 3 things you do to feel better? Write 3 paragraphs where you explain your strategies. Make sure to refrain from starting a sentence with "And", "But", and "Because

Answers

  One thing that I do that makes me feel better is that I draw when I am sad. This makes me feel better becuase Its what I love to do alll of the time and I also draw how I feel so people would understand how I feel.

The second thing I do to make me feel less down is sing. I sing my feelings and that helps me alot when I am down and I do many tequniques. .

The third thing I do is talk to someone and tell them how I feel. IT helps alot becuase many people do not know how u feel and if u talk to them they might know how to help you.

There are the three things that help me to be happy.

(------)_(-------)  /\           /\

Answer:

1. Listen to music

2. Sleep

3. Cook

Explanation:

When i am feeling down i often listen to music. Listening to music helps my calm down and think through what my next action is going to be so i don't do anything to rash. Funnily enough listening to song that are filled with rage often work best to calm me down. My theory on this is because it is nice to know that i'm not the only one that has strong feelings no matter what they are.

Sometimes when i am sad i will lay down and take a nap. When i am sad i find that sleeping helps my wake up and feel refreshed and then i can sort through my thoughts. Often times when i am sad it is because i have been up for to long with to much going on and i no longer have control over my own emotions.

Lastly if the first two techniques don't work I will cook. The actual act of cooking does nothing to make me feel better. My family says that when i'm angry or sad is when i cook best and so i cook for them when i am upset, and seeing their faces light up when i bring them food is what makes me feel better.

Simone worked hard at studying. She makes A's now.

Which is the best way to combine these two sentences?
A.
Simone worked hard at studying she makes A's now.
B.
Simone working hard at studying and makes A's now.
C.
Simone worked hard at studying, and she makes A's now.
D.
Since Simone worked hard at studying and making A's now.

Answers

Answer:

C.    Simone worked hard at studying, and she makes A's now.

Explanation:

what is your advocacy as a student​

Answers

Answer:

yes

Explanation:

yes

Answer:

what is the meaning of arvocity

You would read the following with only a tone of seriousness:
During the 1957 World Series, Yankee catcher Yogi Berra noticed that Aaron grasped the bat the wrong way. "Turn it around," he said, "so you can see the trademark." But Hank kept his eye on the pitcher's mound; "Didn't come up here to read. Came up here to hit."


Please select the best answer from the choices provided

T
F

Answers

Answer:

False

Explanation:

Took the test on edge

During the 1957 World Series, Yankee catcher Yogi Berra noticed that Aaron grasped the bat the wrong way. "Turn it around," he said, "so you can see the trademark." But Hank kept his eye on the pitcher's mound; "Didn't come up here to read. Came up here to hit." This, statement is false. Thus, option (b) is correct.

What is happens in 1957 World Series?

The 1957 World Series pitted the American League's reigning champion New York Yankees against the National League's Milwaukee Braves. The Braves won the series in seven games, defeating the Yankees. The series aired from October 2 through October 10, 1957.

Throughout his judicial career, Oliver Wendell Holmes, nicknamed as "the Great Dissenter," was noted for his independence. It is believed that when Sherlock was in his eightieth year. During the 1957 World Series, Yankee catcher Yogi Berra spotted Aaron grasping the bat incorrectly.

As a result, the significance of the statement is false is the aforementioned. Therefore, option (b) is correct.

Learn more about on World Series, here:

https://brainly.com/question/30399116

#SPJ2

Which of the following is the best interpretation of the line: “The jar was gray and bare.” a. The jar is unimaginative. c. The jar is protected from the wilderness. b. The jar is in need of paint. d. The jar is technology.

Answers

Answer:

b. The jar is in need of paint.

Explanation:

The best interpretation of the line: “The jar was gray and bare.” is that the jar needs a paint job.

The line shows that the jar being gray means that it needs a color, because the cor gray is dull and being bare means its unappealing because there's nothing attractive about it.

5)Complete these sentence halves using your own words. You should use a to-infinitive in
each one

a)He arrived too late ...

d)Your brother has gone...

b)Do you understand where ...?

e)I'd like you....

c)The students need a library...

English ain't my thing for real​

Answers

a) to give his wife the flowers.

d) to work.

b) to go?

e) to remain humble.

c) card to check out books.

I need help please !!!!!

Answers

It is A

plz what is your favoirte song by drake

Answer:

c

Explanation:

Please help guy
Which element of the plot does the last paragraph represent?
1. the exposition
2. the conflict
3. the climax
4. the resolution

Answers

I believe it would be the conflict :)

Whats the Answer to this please EXPLAIN your answers Giving Brainliest Lol:) XD lol

Answers

Answer:

Students should be free to choose there own cafeteria seats because it can weaken friendships

Explanation:

Hala missed class today because she’s not _____, even though she’s a _____ student.
Select one:

a.
well; well

b.
well; good

c.
goodly, wellish

d.
good; well

e.
good; good

Answers

It would be b because it makes a lot more sense

Answer:

b

Explanation:

well

good

Which of the following is NOT a characteristic of a dystopian novel?
A. It occurs in a supposedly perfect society that has gone too far.
B. The main character must try to reconcile his/her individuality to the structure of the
society in which he/she lives.
C. Fantastical creatures that evoke imagination.
D. The characters' lives and individuality are restricted.

Answers

The answer to your question would be the letter C.
- "The novel occurs in a realistic setting."
:)

The following is NOT a characteristic of a dystopian novel Fantastical creatures that evoke imagination. Thus the correct option is C.

What is a dystopian novel?

The dystopian category imagines environments or civilizations in which sorrow characterizes human society and living is exceptionally challenging due to persecution, fear, or other negative factors.

To create excitement about actual current events, dystopian fiction is frequently set in a relatively away future. Science fiction is required since dystopian literature and film are contemporary in nature.

The dystopian novel is interesting to teenagers because of their uniqueness and how they view the world, which appeals to their interests. They also find it familiar because the novels are typically portrayed from the viewpoint of youth.

Therefore, option C is appropriate.

Learn more about dystopian novels, here:

https://brainly.com/question/15024005

#SPJ2

Help me please! Who is less skillful

Answers

the less skillful person is the amateur because they’re not actually meant to be skilled in whatever sport activity they’re in.

Which of the following novels is not an example of science fiction?
A. Journey to the Center of the Earth
B. Wizard of Oz
C. Frankenstein
D.War of the worlds

Answers

B duhhhh bc it’s fake

Answer:

b

Explanation:

In the wizards of oz they talk about a girl who passes out from a tornado and dreams about being in a magical place.

what languages does jane eyre study? (check all that apply)

French
german
hindostanee
english
Spanish
italian​

Answers

I would say friend and German I’m sorry if I’m wrong

Answer:

Hindostanee, french, german, english

Explanation:

Why might the author have used the metaphor "bricks
of ... faith" in "Empire State Building"?
1:
to show how the building was constructed
2:
to show the concepts of great size and strength
3:
to describe what the bricks look like
4:
to show how tall the building is

Answers

It’s number 2: to show the concepts of great size

Answer:

to show the concepts of great size and strength

so it's B

Explanation:

"Why might the author have used the metaphor"

I am ten million bricks of unshakable faith. that tells ya the answer.

What example of figurative langue is this line?

Wolf huffed and puffed and blew and blew
1.alliteration
2.irony
3.personification
4. onomatopoeia

Answers

This is personification because it is giving an animal, who normally has no character traits, actions and something to do

Answer:

the answer to your question is personification

read this from frida hhhhhhhhhhhhhhhuuuuuuuuuurrrrrrrrrrrrrrrryyyyyy

she was in almost unbearable pain an agony that would persist for the rest of her life . in terrifying nightmares accident she relived the accident and heared the screams of the other victims .

the descriptive detail in this sentence show


A how kahlo looked

B what kabol to overcome
C what kahol became successful

Answers

Answer:C.

Explanation:

To show what Kahlo had to overcome.

Answer:

Your answer should be

What  Kahlo had to overcome.

Hope it helps!!!

Find
Find five simple sentences. Explain why they are simple. What do you
notice about the length of simple sentences?
f.​

Answers

Answer:

eat sit to to do only this are simple sentence

Can you guys PLEAAAASEEEE HELP MEEE with my other two questions I've postedddd! I'm desperate :')

Answers

Answer:

Ok

Explanation:

Which sentence has the correct comma placement? Mark Twain was fond of condemning lying by saying “If you tell the truth, you don’t have to remember anything.” Mark Twain was fond of condemning lying by, saying “If you tell the truth, you don’t have to remember anything.” Mark Twain was fond of condemning lying by saying, “If you tell the truth, you don’t have to remember anything.”

Answers

Answer:

“If you tell the truth, you don’t have to remember anything.”

Explanation:

There you go

Answer:

Mark Twain was fond of condemning lying by saying, “If you tell the truth, you don’t have to remember anything.”

A holiday that people in my culture celebrate is?

Answers

Answer:

Hanukkah, Kwanzaa, diwali

Explanation:

Answer:

America: New Year, Independence Day, Christmas, or Halloween. Jews: Hanukka, Yom Kippur, or Rosh Hashanah. Muslims: Eid

Explanation:

1, my father has____ may, so he can buy me something? A, a little B,little C,few D,a few​

Answers

Answer:

a little

Explanation:

few and A few are grammatically incorrect because they usually describe numbers. Depending on the context of the sentence it could be either a little or little. A little stands for some or a small amount while little stands for close to nothing. Same for few A few stands for some or a small amount and few would stand for close to nothing.

Which lists the correct bibliographical order and format, based on the standard taught in this unit.
And Now Miguel. Joseph Krumgold. 2007. Crowell: New York.
Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.
And Now Miguel. Joseph Krumgold. 2007: New York, Crowell.
Krumgold, Joseph. And Now Miguel. Crowell: New York, 2007.

Answers

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

Explanation:

If you look at notes you've taken you will find the format you need to use to write these things.

Answer:

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

Explanation:

Sample entry:

Bulla, Clyde Robert. Squanto, Friend of the White Men. New York: Thomas Y. Crowell Co.,

1954.

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

When you have more than one source, arrange your entries in alphabetical order by the author's last name.

Sample entries:

Bulla, Clyde Robert. Squanto, Friend of the White Men. New York: Thomas Y. Crowell Co.,

1954.

Field, Rachel. Calico Bush. New York: Dell Publishing, 1931.

I WILL DO BRAINLIEST!

3. What is emphasized in William Carlos Williams's "Landscape with the Fall of Icarus" but not in Pieter Brueghel's Landscape with the Fall of Icarus? What conclusions can you draw about the similarities and differences between the themes of the two works?

Answers

Answer:

William Carlos Williams emphasizes spring in “ Landscape with the Fall of Icarus”, but in PieterBrueghel’s Landscape with the Fall of Icarus, you can see that the person in front is wearinglong sleeves, which doesn’t emphasize spring.

Explanation:

All of the following kinds of writing could reasonably and purposefully use alliteration EXCEPT
A: Formal business letter
B: old poem
C: a passage from a narrative
D: speech by a character in a play

Answers

Answer:

A: Formal business letter

Explanation:

Alliteration is the use of similar sounding end words in a sentence. An example would include "Peter's papa paid people to play the piano".

Alliteration is mostly used by artists and in informal settings, therefore, using alliteration in a formal business letter would be considered inappropriate.

The girl said, ‘I did not attend the programme yesterday​

Answers

Answer:

Ooooooooohhh she didntt attenddd how sadd

Answer:

Ohhhhhhhh. She didn't attain the program Soo sad

Explanation:

Lol

roast me in the comments

Answers

Answer:

Mirrors can't talk, lucky for you they can't laugh either <3

Answer:

i got u covered

Explanation:

You’re the reason God created the middle finger.

You’re a grey sprinkle on a rainbow cupcake.

If your brain was dynamite, there wouldn’t be enough to blow your hat off.

You are more disappointing than an unsalted pretzel.

Light travels faster than sound which is why you seemed bright until you spoke.

You have so many gaps in your teeth it looks like your tongue is in jail.

Your secrets are always safe with me. I never even listen when you tell me them.

I’ll never forget the first time we met. But I’ll keep trying.

I forgot the world revolves around you. My apologies, how silly of me.

I only take you everywhere I go just so I don’t have to kiss you goodbye.

Hold still. I’m trying to imagine you with personality.

Your face makes onions cry.

You look so pretty. Not at all gross, today.

When men and women are separated in Birkenau, Eliezer —
A) misses his sisters terribly
B) tries to get news about his mother
C) wishes he had gone with his mother
D) never sees his mother and youngest sister again

Answers

Answer:

D. He never sees his mother and youngest sister again

Explanation:

He goes with his Father and never sees them again.

Other Questions
What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab?