What is 5 - (-2) =
Plz help I’m thinking it’s 3 but don’t know

Answers

Answer 1
5-(-2) is 7. 2 negatives is a positive. It’s basically 5+2.
Answer 2

Answer:

7

Step-by-step explanation:

just add them

them you get answer


Related Questions

Andrew is saving up money for a down payment on a car. He currently has $3355, but knows he can get a loan at a lower interest rate if he can put down $4045. If he invests the $3355 in an account that earns 3.7% annually, compounded monthly, how long will it take Andrew to accumulate the $4045? Round your answer to two decimal places, if necessary.

Answers

Answer:

5.06 years or 60.75 months

Step-by-step explanation:

Compound interest formula:

[tex]AV=PV(1+\frac{i}{n})^{n*t}\\4045=3355(1+\frac{.037}{12})^{12t}\\1.025=(1.003)^{12t}\\log1.025_{1.003}=12t\\60.75=12t\\5.062[/tex]

5.06 years or 60.75 months

It will take Andrew  5 years to accumulate $4045 by investing $3355 in an account that earns 3.7% annually, compounded monthly.

What is Percentage?

percentage, a relative value indicating hundredth parts of any quantity.

We can use the formula for compound interest to solve this problem:

[tex]A = P(1 + r/n)^(^n^t^)[/tex]

where:

A is the amount of money at the end of the investment period

P is the principal amount (initial investment)

r is the annual interest rate (as a decimal)

n is the number of times the interest is compounded per year

t is the time (in years) of the investment period

In this case, we want to solve for t. We know that:

P = $3355

r = 0.037 (3.7% as a decimal)

n = 12 (compounded monthly)

A = $4045

Substituting these values into the formula, we get:

[tex]4045 = $3355(1 + 0.037/12)^(^1^2^t^)[/tex]

ln(1.206) = 12t ln(1 + 0.037/12)

ln(1.206) = 12t ln(1 + 0.0031)

ln(1.206) = 12t ln(1.0031)

0.187=12t 0.0031

0.187=0.0372t

t=5.02

Therefore, it will take Andrew approximately 5 years to accumulate $4045 by investing $3355 in an account that earns 3.7% annually, compounded monthly.

To learn more on Percentage click:

https://brainly.com/question/24159063

#SPJ2

Please help no links

Answers

Answer: Big rectangle shades 1/4+1/2

Step-by-step explanation:

So have a Big

Please answer correctly!

Answers

Answer:

B. 1296 m^3

Step-by-step explanation:

To find the volume of a square pyramid, multiply the base by itself twice, then divide the height by 3. After getting both answers, multiply the answers.

In this case, the base is 18.

The height is 12.

First, we must multiply the base by itself twice.

18⋅18 = 324.

Next, divide the height by 3.

12/3 = 4.

Now that we have both answers, we multiply them.

324 ⋅ 4 = 1,296.

Therefore, 1,296 cm^3 is the volume of the square pyramid.

.222222222 as a fraction Please help

Answers

Answer:

222222222/1000000000

Step-by-step explanation:




1. (1 point) Let x be a real number. Show that a (1 + x)2n > 1+ 2nx for every positive integer n.

Answers

For a real number x, by using mathematical induction it is shown that a[tex](1 + x)^{2n}[/tex] > 1 + 2nx for every positive integer n.

To prove the inequality a[tex](1 + x)^{2n}[/tex] > 1 + 2nx  for every positive integer n, we will use mathematical induction.

The inequality holds true for n = 1, and we will assume it is true for some positive integer k.

We will then show that it holds for k + 1, which will complete the proof.

For n = 1, the inequality becomes a[tex](1 + x)^2[/tex] > 1 + 2x.

This can be expanded as a(1 + 2x + [tex]x^2[/tex]) > 1 + 2x, which simplifies to a + 2ax + a[tex]x^2[/tex] > 1 + 2x.

Now, let's assume the inequality holds true for some positive integer k, i.e., a[tex](1 + x)^{2k}[/tex] > 1 + 2kx.

We need to prove that it holds for k + 1, i.e., a[tex](1 + x)^{2(k+1)}[/tex] > 1 + 2(k+1)x.

Using the assumption, we have a[tex](1 + x)^{2k}[/tex] > 1 + 2kx.

Multiplying both sides by [tex](1 + x)^2[/tex], we get a[tex](1 + x)^{2k+2}[/tex] > (1 + 2kx)[tex](1 + x)^2[/tex].

Expanding the right side, we have a[tex](1 + x)^{2k+2}[/tex] > 1 + 2kx + 2x + 2k[tex]x^2[/tex] + 2[tex]x^2[/tex].

Simplifying further, we get a[tex](1 + x)^{2k+2}[/tex] > 1 + 2(k+1)x + 2k[tex]x^2[/tex] + 2[tex]x^2[/tex].

Since k and x are positive, 2k[tex]x^2[/tex] and 2[tex]x^2[/tex] are positive as well.

Therefore, we can write a[tex](1 + x)^{2k+2}[/tex] > 1 + 2(k+1)x + 2k[tex]x^2[/tex] + 2[tex]x^2[/tex] > 1 + 2(k+1)x.

This proves that if the inequality holds for some positive integer k, it also holds for k + 1.

Since it holds for n = 1, it holds for all positive integers n by mathematical induction.

Therefore, we have shown that a[tex](1 + x)^{2n}[/tex] > 1 + 2nx  for every positive integer n.

Learn more about mathematical induction here:

https://brainly.com/question/29503103

#SPJ11

Find the lateral area of this square
based pyramid.
10
ft
10 ft
[ ? jft?

Answers

Answer:

200

Step-by-step explanation:

happy to help

The lateral area of  square based pyramid is 200 square feet

What is Three dimensional shape?

a three dimensional shape can be defined as a solid figure or an object or shape that has three dimensions—length, width, and height.

The given square base pyramid has four faces of triangles and one square shape base

The lateral surface area of pyramid formula 4 × (1/2)bl,

b = side length of the base, and

l = slant height

Lateral surface area =2 bl

=2×10×10

=200 square feet

Hence,  the lateral area of  square based pyramid is 200 square feet

To learn more on Three dimensional figure click:

https://brainly.com/question/2400003

#SPJ2

question in screenshot

Answers

Answer:

10

Step-by-step explanation:

use pythagorean theorm

√(8^2+6^2) = 10

The point P(2,12) lies on the curve y=x2+x+6. If Q is the point (x,x2+x+6), find the slope of the secant line PQ for the following values of x.
If x=2.1, the slope of PQ is:
and if x=2.01, the slope of PQ is:
and if x=1.9, the slope of PQ is:
and if x=1.99, the slope of PQ is:
Based on the above results, guess the slope of the tangent line to the curve at P(2,12).

Answers

Based on the results, we can observe that as x approaches 2, the slopes of PQ are getting closer to 4. Therefore, we can guess that the slope of the tangent line to the curve at P(2,12) is approximately 4.

To find the slope of the secant line PQ, we need to determine the coordinates of point Q and then calculate the slope using the formula:

slope = (change in y) / (change in x)

Given that Q is the point (x, x^2 + x + 6), we can substitute the values of x to find the corresponding slopes.

If x = 2.1:

Q = (2.1, (2.1)^2 + 2.1 + 6) = (2.1, 12.51)

Slope of PQ = (12.51 - 12) / (2.1 - 2) = 0.51 / 0.1 = 5.1

If x = 2.01:

Q = (2.01, (2.01)^2 + 2.01 + 6) = (2.01, 12.0601)

Slope of PQ = (12.0601 - 12) / (2.01 - 2) = 0.0601 / 0.01 = 6.01

If x = 1.9:

Q = (1.9, (1.9)^2 + 1.9 + 6) = (1.9, 11.61)

Slope of PQ = (11.61 - 12) / (1.9 - 2) = -0.39 / -0.1 = 3.9

If x = 1.99:

Q = (1.99, (1.99)^2 + 1.99 + 6) = (1.99, 11.9601)

Slope of PQ = (11.9601 - 12) / (1.99 - 2) = -0.0399 / -0.01 = 3.99

Based on the results, we can observe that as x approaches 2, the slopes of PQ are getting closer to 4. Therefore, we can guess that the slope of the tangent line to the curve at P(2,12) is approximately 4.

Learn more about slopes  here:

https://brainly.com/question/3605446

#SPJ11

A game has a 10-sided die. What is the probability of rolling a number less than 3 or an odd number? All answers should be in FRACTION form ONLY.

Answers

The probability of rolling a number less than 3 or an odd number is 3/5 in fraction form.

To compute the probability of rolling a number less than 3 or an odd number, we need to calculate the probability of each event separately and then subtract the probability of their intersection.

The probability of rolling a number less than 3 is 2/10, as there are two numbers (1 and 2) that satisfy this condition out of the ten possible outcomes.

The probability of rolling an odd number is 5/10, as there are five odd numbers (1, 3, 5, 7, and 9) out of the ten possible outcomes.

To compute the probability of their intersection (rolling a number less than 3 and an odd number), we observe that there is only one number (1) that satisfies both conditions.

Therefore, the probability of their intersection is 1/10.

To compute the probability of rolling a number less than 3 or an odd number, we sum the probabilities of each event and subtract the probability of their intersection:

Probability of rolling a number less than 3 or an odd number = (2/10) + (5/10) - (1/10) = 6/10 = 3/5.

Therefore, the probability of rolling a number less than 3 or an odd number is 3/5.

To know more about probability refer here:

https://brainly.com/question/32117953#

#SPJ11

Please answer these 3 answers correctly

Answers

Answer: 3. Tan; 4. 4.76; 5. 12

Step-by-step explanation: First question: SOH CAH TOA; if you draw a picture with the given information you know the Opposite and Adjacent sides to the upper left angle, or OA which is also Tan according to Soh Cah Toa. Second question: Use inverse tan(1/12) to solve. Third question: Same idea as the last question but use inverse sin(1/5)

need help with this one lol

Answers

Answer: 5 + 47 = 108

Step-by-step explanation: dont worry it works

Answer:

pythagoras thoerem

Step-by-step explanation:

y squared = 10 squared - 7 squared

y = 100 - 49= 51

y square root of 51 =7.1

Always in the game and never played by the rules (rules)
Tried to let me leave (leave), fell down to my knees (knees)
Picked myself up and turned my back to the breeze, oh-oh
Spent a milli' on a milli', mama look at me (oh)
With all these diamond chokers, man, it's gettin' hard to breathe

Answers

If you made this Very good job. I like it, and its hard to make a song i like. i like about 60 songs total out of the 10000+ ik of

Having an error of 0.01, a confidence level of 95% with a value p = 0.37 Determine: a) Z-value b) Sample size

Answers

a) The Z-value corresponding to a confidence level of 95% can be determined as 1.96.

b) To determine the required sample size, we need additional information such as the population size or an estimated proportion. Without this information, we cannot calculate the sample size.

a) The Z-value represents the number of standard deviations a data point is from the mean in a standard normal distribution. For a confidence level of 95%, which corresponds to a 5% significance level, the critical Z-value is approximately 1.96. This value can be obtained from a Z-table or using statistical software.

b) To calculate the required sample size, additional information is needed, such as the population size or an estimated proportion. The sample size formula takes into account factors such as the desired margin of error, confidence level, and variability. Without these details, it is not possible to determine the sample size accurately.

To learn more about errors click here: brainly.com/question/13286220

#SPJ11

Find the missing side​

Answers

Answer:

72

Step-by-step explanation:

Answer:

72 units

Step-by-step explanation:

The Pythagorean Theorem states that [tex]a^2+b^2=c^2[/tex] in a right triangle when a and b are the two legs and c is the hypotenuse (the longest side).

[tex]a^2+b^2=c^2[/tex]

In the diagram, 30 measures one of the legs and 78 measures the hypotenuse. Plug these in as a and c.

[tex]30^2+b^2=78^2\\900+b^2=6084[/tex]

Subtract 900 from both sides

[tex]900+b^2-900=6084-900\\b^2=5184[/tex]

Take the square root of both sides

[tex]900+b^2-900=6084-900\\\sqrt{b^2} =\sqrt{5184}\\b=72[/tex]

Therefore, the length of the missing side is 72 units.

I hope this helps!

I ask for your help fellow strugglers

Answers

Answer: C is false

Step-by-step explanation: If B is correct and C is saying otherwise that must mean it's the only false choice :) brainliest would be appreciated :)

Can someone please help me please I really need help please answer it correctly

Answers

Answer:

Princeton Florist

Let the total charge is y, the number of small arrangements is x.

Total charge will be:

y = 13x + 47Chad's Flowers

Total charge will be:

y = 17x + 35

Since the total charge is same in both shops, we have:

13x + 47 = 17x + 35

Solve for x:

17x - 13x = 47 - 354x = 12x = 3

Total cost is:

13*3 + 47 = 39 + 47 = 86

Small arrangements = 3, cost = $86

Let C41 be the graph with vertices {0, 1,..., 40} and edges (0-1), (1-2),..., (3910), (100), and let K41 be the complete graph on the same set of 41 vertices. You may answer the following questions with formulas involving exponents, binomial coefficients, and factorials. (a) How many edges are there in K41? (b) How many isomorphisms are there from K41 to K41? (c) How many isomorphisms are there from C41 to C41? (d) What is the chromatic number (K41)? (e) What is the chromatic number (C41)? (f) How many edges are there in a spanning tree of K41? (g) A graph is created by adding a single edge between nonadjacent vertices of a tree with 41 vertices. What is the largest number of cycles the graph might have? (h) What is the smallest number of leaves possible in a spanning tree of K41? i) What is the largest number of leaves possible in a in a spanning tree of K41? G) How many spanning trees does C41 have?

Answers

(a) The complete graph K41 has 820 edges. This can be calculated using the formula for the number of edges in a complete graph, which is given by the expression (n(n-1))/2, where n is the number of vertices. Substituting n = 41, we get (41(41-1))/2 = 820.

(b) The number of isomorphisms from K41 to itself is equal to the number of permutations of the vertices. This can be calculated as 41!, which represents the number of ways to arrange the vertices of K41.

(c) The graph C41 is not isomorphic to itself because it has a specific edge pattern. Thus, there are no isomorphisms from C41 to itself.

(d) The chromatic number of K41 is equal to its number of vertices, which is 41. This is because each vertex can be assigned a unique color, and no two adjacent vertices share the same color in a complete graph.

(e) The chromatic number of C41 is 2. This is because C41 contains a Hamiltonian cycle, which is a cycle that visits each vertex exactly once. A Hamiltonian cycle can be colored with only two colors, where adjacent vertices are assigned different colors.

(f) A spanning tree of K41 is a connected acyclic subgraph that includes all the vertices of K41. The number of edges in a spanning tree of K41 is equal to the number of vertices minus 1, which is 41 - 1 = 40.

(g) If a single edge is added between nonadjacent vertices of a tree with 41 vertices, the largest number of cycles the graph might have is 41. This can occur when the new edge connects two vertices that are at maximum distance from each other in the original tree, resulting in a new cycle.

(h) The smallest number of leaves possible in a spanning tree of K41 is 1. This can be achieved by removing all but one edge from K41, resulting in a single leaf node.

(i) The largest number of leaves possible in a spanning tree of K41 is 40. This can be achieved by removing all but one vertex from K41, resulting in a single vertex connected to 40 leaf nodes.

(g) The number of spanning trees that C41 has can be calculated using Cayley's formula, which states that a complete graph with n vertices has nn-2 spanning trees. Substituting n = 41, we get 4141-2 = 240 spanning trees for C41.

To know more about isomorphisms ,visit:
https://brainly.com/question/31984928
#SPJ11

What is 0.0003246 expressed in scientific notation?
A.
32.46
×
10

5
B.
3.246
×
10

4
C.
3.246
×
10
4
D.
32.46
×
10
5

Answers

Answer:

B

Step-by-step explanation:

the notation answer would also be 3.246 × 10-4 i believe :)

Given the angles in the diagram below what is m<2?

Answers

Answer: 98

Step-by-step explanation: According to the corresponding angles theorem m<1=82. Then according to the linear supplements theorem m<2=98. Hope this helps!

Answer:

98°

Step-by-step explanation:

Angle 1 also measures 82° because it is a corresponding angle to the given angle. Angles 1 and 2 are supplementary and therefore must add up to 180°.

PLS HELP ILL MARK U BRAINLIEST
I DID THE FIRST 1 I NEED HELP WITH THE SECOND <3

Answers

Answer:

7m and 49 m^2

Step-by-step explanation:

i am not sure on the second answer

Solve the equation using either addition or substitution. Show all your work

Answers

Answer:

(x1, y1) = (1, 3)

(x2, y2) = (4, 12)

Step-by-step explanation:

y= x^2 - 4

y= 5x - 8

(substitute the value for y)

x^2 - 4 = 5x - 8

(solve the equation)

x = 1

x = 4

(substitute the values)

y = 5 × 1 - 8

y = 5 × 4 - 8

(solve the equations)

y = -3

y = 12

( the possible solutions are)

x1, y1 = 1, -3

x2, y2 = 4, 12

(check the solutions)

-3 = 1^2 - 4

-3 = 5 × 1 - 8

12 = 4^2 - 4

12 = 5 × 4 - 8

(simplify)

-3 = -3

-3 = -3

12 = 12

12 = 12

(the ordered pairs are the solutions)

PLSSS HELP IMMEDIATELY!!!! i’ll mark brainiest if u don’t leave a link!

Answers

Answer:

grab objects

Step-by-step explanation:

barrels and things like that would most likely grab objects so the fish can have room to swim and stuff

please help due in a few hours!

Answers

Answer:

54 cm²

Step-by-step explanation:

1 cm= 3 m

2 cm= 6 m

3 cm= 9 m

9×6=54

Area of bedroom= 54 cm²

198cm^2 is the correct answer

The points where a graph crosses the x- and y-axis are called the __

Answers

Answer:

x-intercept

y-intercept

Step-by-step explanation:

Answer:

x-intercept y-intercept

As reported in Runner's World magazine, the times of the finishers in the New York City 10-km run are normally distributed with mean 60 minutes and standard deviation 9 minutes. Determine the percentage of finishers who have times between 55 and 75 minutes.

Answers

The mean of the finishers in the New York City 10-km run is 60 minutes and standard deviation is 9 minutes.

To determine the percentage of finishers who have times between 55 and 75 minutes, we need to find the Z-scores for both of these values as follows:

Z1 = (55 - 60) / 9 = -0.56Z2 = (75 - 60) / 9 = 1.67

Now, we need to find the area under the standard normal distribution curve between these two Z-scores as follows:

P(-0.56 < Z < 1.67) = P(Z < 1.67) - P(Z < -0.56) Using a standard normal distribution table,

we can find the probabilities as:

P(Z < 1.67) = 0.9525P(Z < -0.56) = 0.2881

Therefore , P(-0.56 < Z < 1.67) = P(Z < 1.67) - P(Z < -0.56)= 0.9525 - 0.2881= 0.6644Therefore, the percentage of finishers who have times between 55 and 75 minutes is 66.44%.

To know more about mean and standard deviation click here

https://brainly.com/question/30368761

#SPJ11

A 4 pack of 12-ounce bottles of water costs $4.40. What is the cost per ounce?

Answers

Answer:

5

Step-by-step explanation:

simplify log(16x²) ± 2㏒(1÷×)

Answers

Answer: just simplify condense it then your answer will be log(16)

what is the area of 1 1/5 width and 1 1/3 length

Answers

Answer:

1.6 unit^2 (dec. form) or 1 3/5 unit^2 (frac. form)

Step-by-step explanation:

(1 1/5)(1 1/3)

(6/5)(4/3)

1.6 unit^2 (dec. form) or 1 3/5 unit^2 (frac. form)

The diameter of a circle is 6 kilometers. What is the area?

d=6 km

Give the exact answer in simplest form.
square kilometers

Answers

Answer:

28.27 rounded orrrr 28.27433388 not rounded.

Step-by-step explanation:

area of circle=πr^2

radius=3 km

3^2=9

9*π

Step-by-step explanation:

Area of a circle = πr²

Radius (r) =1/2 Diameter

=60/2

=30km

Area = π x (30)²

= π x 900

= 2027km²

What should you do first when you simplify the expression below? (5+4)x3

Answers

Answer:

5 + 4 snice it's inside the circle and when you get your answer you times it with 3

Step-by-step explanation:

( 5 + 4 ) x 3

  9 x 3

27

(5+4) x 3 = 27

Other Questions
Consider a regular surface S given by a map x: R2 R3 (u, v) (u +0,- v, uv) For a point p= (0,0,0) in S, Compute N.(p), N. (p) Lester Young is known for his innovative characteristics as a soloist. All except one of the characteristics on the following list are correct. Which one of the following is NOT a characteristic of Young's solo style?a. Young began to phrase his solos across the customary 4-bar and 8-bar boundaries, lending his sound a more relaxed fluidity b. Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins c. Young "floated" his tones as though defying gravity historically, demand has averaged 408 units per week with a standard deviation of 160. the company currently has 48 units in stock. what is the probability of a stockout?a.225.0% b. 48.778% c.1.222% d..98.778% e.50.000% One of the tables below contains (X, Y) values that were generated by a linear function. Determine which table, and then write the equation of the linear function represented by the:Table #1:X 2 58111417 20Y1 3713213143Table #2:X 1234567Y 10 13 18 21 26 29 34Table #3:X2 4 6 8101214Y1 61116212631Equation of a Line in:A line in R is composed of a set of ordered pairs possessing the same degree of slope.To structure the equation of a line, we must have a point (a,b) and the slope. Which of the following is not an example of a capital investment? ...Which of the following is not an example of a capital investment? A.)The implementation of a new manufacturing technique.B.)The purchase of raw materials for inventory.C.) The installation of a computer based record keeping system. D.)The expansion of a business into new territories. E.)The purchase of new manufacturing equipment. Vera has an adjustable-rate mortgage, and her monthly payments are reset annually based on the prevailing market rate. She is wondering about the effect of an increase of 0.5 percent in the interest rate on her mortgage payment. Vera is O displaying traits of an agonizer. O conducting a sensitivity analysis. O estimating her opportunity cost. O conducting incremental analysis. discuss the link between agenda setting and the development of legislation. the function analogwrite(5, 100), will produce how much average voltage on pin 5? group of answer choices between 0 to 2 volt between 2 v to 5 v 5 v 100 v as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate.