What happens when black holes accrete matter too quickly?

Answers

Answer 1

Answer:

These objects are called quasars, or active galactic nuclei. However, most black holes are too compact to pull such material — which is mostly gas — in immediately. ... Eventually, the gas is moving so fast that it gets extremely hot and luminous, generating radiation that we can often see from Earth.

Explanation:


Related Questions

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies

Distinguish between dimorphic, polymorphic, and continuously variable traits.

Answers

Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:

Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.

When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.

Continuously variable traits are those that show a continuous distribution of phenotypes.

Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.

Learn more about polymorphic traits here: https://brainly.com/question/7882029

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

pls help click the link answer​

Answers

Answer:

1. Transfer

2. Share

3. Subscript

4. Positive

All of the following would result in a population increase except

- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate

Answers

Answer: B

Explanation: because birth and immigration is making the group bigger zero deaths and animals leaving
Hope this helps.

The answer I would choose is a low birth rate.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

Answers

Answer:

FM radios and TV remote controls.

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

Help help bell help help

Answers

6 units
because it is decreasing by three every time

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Answers

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

https://brainly.com/question/5186929

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

Answers

Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).

Explanation:

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

muscle cell labelled diagram ​

Answers

Explanation:

Here is a diagram, let me know if this is what you needed.

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!
Other Questions
How does the process of ridge push cause the formation of new oceans?Ridge push causes a rift valley; as the plates move apart, a new ocean basin forms, filling with water and eventually becoming a mature ocean.Ridge push causes a convergent plate boundary; as the plates move together, new islands form, which trap water between them, causing an ocean to form.Ridge push causes plates to move apart from one another, creating a deep trench that eventually widens enough to become a new ocean.Ridge push causes the plates to subduct, causing a deep trench that eventually fills with water and becomes a new ocean. A pair of shoes sell for $75 from the manufacturing company. If the store sells the shoes for $150 dollars what is the mark-up (percent increase) of the price of the shoe from the manufacturing company to the store?Help Please help with this math problem!! IT'S DUE TONIGHT AT 11:59PM!! NO LINKS PLEASE!! :) Hey! Uh sorry for asking like a lot but how did Muslims advance in Mathematics?50 points + brainilest! :D :D :Dif you don't know don't worry! Which energy substance is a DIRECT source of energy used by the body to perform a multitude of functions, such as muscle contraction I need some rare car brands for my channel please do not include Mitsubishi, pontiac, and mazda. Explain what happens to the egg following fertilization, make sure you use the word "cells" and "chromosomes" in your answer. Please HELP!!! Which of the following quadrants of the standard (x,y) coordinate plane contain points on the graph of the equation 6x 3y = 9 ?A. l and lll onlyB. l, ll and lll onlyC. l, ll and IV onlyD. I, II and IV onlyE. II, IIIand IV 5. PART A: How did Karl Marx's life change after he published "The Communist Manifesto"? (RI.1.3)A. He made a fortune.B. He was rejected by many for his views.C. He became less outspoken.E. He grew more passionate about his beliefs.6. PART B: Which section from the text best supports the answer to Part A? (RI.1.1)A. "Marx became a homeless exile searching for a country that would tolerate his revolutionary views."(Paragraph 19)B. "He had three main goals, which he pursued for the rest of his life by penning innumerable newspaperarticles and serious scientific studies" (Paragraph 20)C. C. "The pay checks kept his large family from going hungry until the start of the American Civil War."(Paragraph 21)D. "the establishment of a perfectly just society where everyone would be equal and work would cease to be aburden." (Paragraph 25) There were approximately 16 million visitors to Disneyland in 2012. If the theme park is open every day of the year, about how many people visit per day? what three things are produced during the light reaction Pls help with my maths!!! Hey dumpling , I wish your online to see this message lelz These are samples of student work. Both students got the same answer, but did the work differently. Which student did the work correctly? 3. Why are black holes important to our universe? PLEASE NO LINKS AND NO NEGATIVITY what are some objections that you may hear from a potential employer? gaging Structure This student example uses less engaging sentence structure. What could be improved? Check all that apply. It could vary the word Please help!! I need this ASAP work out the value of (3^(12) +3^(5) ) + (3^(2) x 3)