Answer:
particles would stop moving
Explanation:
Answer:c
Explanation:
ANY ALT PEOPLE HERE
Answer:
LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD
Explanation:
Answer:
thanks for the points
Explanation:
What controls the cell cycle at key checkpoints?
a Regulatory proteins
b Regulatory lipids
C Regulatory carbohydrates
Answer:
a regulatory proteins
Explanation:
njnjnj
Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?
Answer: The basic answer could be because of the tectonics plates.
Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.
Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.
Why are rocks folded?Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.
Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.
Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.
Learn more about rocks, here:
https://brainly.com/question/29561452
#SPJ2
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
what is the function of mitrochondria
Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).
Explanation:
Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.
Explanation:
DNA analysis has little to offer from forensic science
true or flase
Answer:
DNA analysis has little to offer forensic science is false.
Explanation:
DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis
Can someone help me thank you!!
Answer:
CARBON
Explanation:
Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called
1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.
Answer/Explanation:
During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.
But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.
Which macromolecule plays a central role as an energy source?
Answer:
Carbohydrates
Explanation:
Ex: Glucose (monosaccharide)
Why must an mRNA copy be made for Protein Synthesis?
A. Ribosomes cannot read DNA, only RNA.
B. DNA must stay inside the nucleus.
C. Ribosomes are too big to enter the nucleus.
D. DNA is too degenerate to use without mRNA.
Answer:
A
Explanation:
its not D or C and B might be true but its A okay
Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus
Why is mRNA important for protein synthesis?
mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.
Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?
So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.
Learn more about Ribosomes at https://brainly.com/question/8773679
#SPJ2
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
The division of the cytoplasm, which follows Mitosis, is called...
Answer:
Cytokinesis,
Explanation:
Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.
The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.
What is Mitosis?Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.
In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.
Read more about Cell
https://brainly.com/question/2622341
#SPJ2
Why does DNA need to make a transcript of itself and what is this transcript called?
Answer:
DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.
Explanation:
DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.
The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.
As a requirement of the cell division process, as mitosis, DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.
20 points and will mark brainliest!! Explain how you got it!
Answer:
OF COUSE IT C
Explanation:
Answer:
C
Explanation:
I think the answer is C.
The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.
I hope this helps you! Have a great day!
Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element
When you step
on a scale, what is being
measured?
Answer:
Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.
Explanation:
Pls help me
10 points
If a defendant appeals the verdict from a state court of last resort, which
court would most likely hear the appeal next?
A. An intermediate appellate court
B. The U.S. Supreme Court
C. A federal district court
D. A municipal court
SUBMIT
Answer:
b
Explanation: peeps in washington are going crazy.
7. What is a layout of chromosomes in humans in order from largest to smallest with the
sex chromoosomes at the end called?
Answer:
Look down!!! ;)
Explanation:
In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.
Hope this helps!! ;)
When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:
A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.
Answer:
A
Explanation:
the northern hemisphere is the opposite from the southern hemisphere
Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.
Why are the seasons reversed in each hemisphere?The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.
Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.
Learn more about seasons, here:
https://brainly.com/question/12028829
#SPJ2
it takes 25 min to cook 10 egg how long does it take to cook 20
Answer:
it takes 50 min
Explanation:
20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.
Work for it:
10 x 2 = 20
10 eggs=10 min
25x2=50
Answer:
it takes 50 minutes to cook 20 eggs
Explanation:
ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50
hope this helps
how do you think the idea of sustainability influences the work of foresters?
help me
Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia
Answer:
its malaria
Explanation:
I got it wrong and it showed me that it was malaria
MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Someone help me match the last two to their definition
Hypotonic and Isotonic
In pea plants, the allele that produces purple flowers (P) is dominant to the allele that produces white flowers (p), and the allele that produces tall plants (T) is dominant to the allele that produces short plants (t). Two pea plants are crossed and produce 521 offspring, and the results of this cross are shown below:
Phenotype Number of offspring
Tall with purple flowers 291
Short with purple flowers 97
Tall with white flowers 101
Short with white flowers 32
Which cross would MOST LIKELY lead to this outcome?
Pptt × ppTt
pptt × PPTT
PpTt × PpTt
ppTT × PpTt
Answer: PpTt x PpTt
Explanation:
The cross PpTt × PpTt leads to the phenotype Number of offspring Tall with purple flowers 291 Short with purple flowers 97 Tall with white flowers 101 Short with white flowers 32, hence option C is correct.
What is a dihybrid cross?Two creatures that are identically hybrid for two characteristics are said to have mated to create a dihybrid cross. When an organism is heterozygous, it signifies that there are two distinct alleles present at a certain genetic location.
An attempt in producing two creatures that are identical hybrids for two qualities is a dihybrid cross.
The people with this sort of character are homozygous for that particular trait.
Therefore, to put it another way, a dihybrid cross is a union of two organisms that are heterozygous for two separate features, hence option C is correct.
Learn more about dihybrid, here:
https://brainly.com/question/12540319
#SPJ2
Bacteria reproduce in a process called binary fission which of the following is true about binary fission?
Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.
Answer:
genes are segments of chromosomes that form tight coils called dna
The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:
Genes are segments of chromosomes that form tight coils called DNA.Thus, the correct option is D.
What is Chromosome?A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.
Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.
Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.
All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.
Therefore, the correct option for this question is D.
To learn more about Chromosomes, refer to the link:
https://brainly.com/question/11912112
#SPJ6
What size molecules can pass through a cell membrane by a process called passive transport?
Answer:
diffusion and osmosis
Explanation:
lipid_ soluble substance
through lipid baleyer
through protein channel
Transported proteins carry small substances like water, amino acids, and charged ions. One to fifteen angstroms is the range in molecule size that can pass through the membrane. The easier it is for a molecule to move across the cell membrane, the smaller it is.
What is cell membrane ?All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.
Small molecules or ions can traverse the cell membrane passively without the cell providing any energy. The three basic types of passive transport are osmosis, assisted diffusion, and diffusion.
Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes. Water and ethanol are examples of small polar molecules that can move across membranes, though more slowly.
Thus, The easier it is for a molecule to move across the cell membrane, the smaller it is.
To learn more about cell membrane, follow the link;
https://brainly.com/question/13524386
#SPJ2