"What goes around comes around."

1. Describe what this quote means.
2. Explain why or when people may use this quote.

Answers

Answer 1

Answer:

this quote means that what you deal with everyone will in one way or another so if say you were to get a broken window you would say that because it happens to other people.

Explanation:


Related Questions

Help me with this I ready lesson please

Answers

Answer:.

Explanation:

Dr. Bell advised my father to write to Mr. Anagnos, director of the Perkins Institution in Boston, the scene of Dr. Howe's great labours for the blind, and ask him if he had a teacher competent to begin my education. This my father did at once, and in a few weeks there came a kind letter from Mr. Anagnos with the comforting assurance that a teacher had been found. This was in the summer of 1886. But Miss Sullivan did not arrive until the following March.

—The Story of My Life,
Helen Keller

Which is the best summary of this paragraph?

Dr. Bell advised Keller’s father to write to Mr. Anagnos. In a few weeks there came a kind letter saying that a teacher had been found.
In the summer of 1886, Keller’s father wrote a letter asking if there was a teacher for Helen. The teacher did not arrive until March.
Keller’s father contacted the director of the Perkins Institution and requested a teacher for his daughter. After a long wait, Miss Sullivan arrived at the Kellers’ house in March 1887.

Answers

Answer:

It's C

Explanation:

A good summary is a statement of the main points that were made by the speaker in the text. The best summary of the paragraph above is;

Keller’s father contacted the director of the Perkins Institution and requested a teacher for his daughter. After a long wait, Miss Sullivan arrived at the Kellers’ house in March 1887.

A good summary is one where the speaker restates the main points in his own words.

So, the best summary of the paragraph above where the writer expresses the main points in his own word is option C.

Learn more here:

https://brainly.com/question/21750760

Cultural context is
a. the emphasis cultures place on eye contact
b. the relative emphasis cultures place on nonverbal communication
the emphasis cultures place on written verbal communication
d. the emphasis cultures place on learning about other cultures
C

Answers

Answer:

d the emphasis cultures place on learning about other cultures

Which statement best explains the purpose of stage directions found throughout a play?

They describe the characters' movements.

They tell directors how to design the stage.

They reveal what characters say to each other.

They list everyone involved in producing the play.

Answers

Answer: They describe the characters' movements.

Explanation:  Most stage directions tell who is entering or exiting the stage. The stage directions may mention where characters are sitting or standing. They may indicate pauses in the delivery of lines or "asides."

Answer:

A

Explanation:

Can stories have the same power as speeches when it comes to fighting for an issue

Answers

Yes, often more power actually. When you’re trying to convince someone of something the most powerful and swaying argument is one that includes a certain amount of emotion (pathos). So for example, instead of just speaking about dying animals to argue for climate change, it is much more effective to tell a personal or emotional story involving the effects climate change has had a you or other real people. Hope that helps :)

An example of a personal opinion concerning whether stories have the same power as speeches when it comes to fighting for an issue is as follows:

Yes, stories have the same power as speeches and, often, they can be even more persuasive than speeches. A story that is detailed and vivid will convey images more powerfully than a speech, evoking feelings and emotions from the audience.For example, telling the story of someone who has lost everything by describing their poverty clearly - their crying children who are hungry, their one-room house etc. - will be more convincing than simply telling people they should help the poor.

How to write a personal opinion:First, make sure you know enough about the topic to have an opinion concerning it. In case the topic is something you have never reflected about, look it up online or talk to people to get more information.Decide what your opinion is and find information to support it. Statistics, examples, and/or personal anecdotes can help you convince your audience that your opinion is right.If necessary, think of a counterclaim, that is, something people might say to contradict your opinion. Come up with a rebuttal, an answer to the counterclaim.

Learn more about writing opinions here:

https://brainly.com/question/25322172

Can someone help me on this plz i keep getting ignored PLZ HELP ME

Answers

Answer:

If we are being quite honest the first sentence controdicts the piece from  passage 1 by saying that it was the "golden age" of music while the piece says that they had moved on from the old school version of music playing and they could listen to music for hours on end

Explanation:

Starr's Uncle is part of the police department. Check out the following quote and analyze
Starr's internal struggle "On one hand, it's the cops...on the other hand, it's the cops".
Which claim does this statement best support?
O Starr is livid with the police, who she views as the worst individuals in America
O Starr is sympathetic to the police, who she feels are only trying to do what's right
O Star is conflicted on how to proceed because her impressions of the police are directly
interfering with her feelings for her uncle
O Starr is indifferent about the whole situation
Help

Answers

Answer:

C. Starr is conflicted on how to proceed because her impressions of the police are directly  interfering with her feelings for her uncle

Explanation:

The above option is the best statement that supports the claim.

I will answer this to the best of my knowledge. A look at the stated quote shows that there is a conflict in the mind of Starr. It's like moving here, she sees cops and moving there she sees cops. She comes into a state of dilemma which interferes with the feelings for her uncle. From the quote, we can also gather her impression about the police.

Answer:

C. Star is conflicted on how to proceed because her impressions of the police are directly  interfering with her feelings for her uncle

Explanation:

She knows that all cops are not that bad because her Uncle Carlos is one who helps people, not making rash decisions  but she also know that what the other cop did was not called for (just because he was scared) The only reason she goes to the cops is for Carlos's sake, and hoping to see if anything would happen, if the cop be arrested or not. Nothing happened though. "The Hate U Give" By Angie Thomas (Read the book)

Hope that helps

Which detail would be MOST important to include in an objective summary of the passage?


Worldwide, more people are pulling themselves out of extreme poverty than ever before.


According to the World Bank, the number of people living in extreme poverty has dropped by more than half in the past 25 years.


Progress towards eradicating hunger is happening across the world, but poverty is not dropping as it has increased more than half in the past 25 years.


While some countries have successfully lowered their extreme poverty rates in recent decades, there are still many global problems that need to be addressed by 2030.

Answers

Answer:

2 Tu Tu

Explanation:

Didi to to I of if to top do so go to do so we we do t do to is an of sir to us to if to us all ya to of hip of to egg to yr do is

Donde al se sir guble desir la hajae

Animal rights activists are adopting more rescued pets than ever before.

Which sentence contains an appropriate supporting detail for the topic sentence?

A Most people believe that animal rights are not more important than human rights.

B Animal rights activists have trouble finding places to adopt pets despite the increasing number of pets available for adoption.

C Animal rights activists refuse to adopt purebred animals because they’re against breeding animals in captivity.

D About 35 percent of all rescued animals are adopted by people who are involved with the animal rights movement.

E About 7 million animals enter animal shelters each year, but only about 3 million animals are adopted.

HELP ME IM IN A SEMESTER TEST

Answers

Answer:

I would say D

Explanation:

Answer:

c

Explanation:

word related with English​

Answers

anglophone

Pls give Brainiest

Write an article about handball. Write what equipment you need and why you like it.

Answers

Answer:

Handball

Explanation:

I like Handball because it brings joy to kids/Teens/And more, its a well known game. The reason i like this game is because its competitive. You need at least one ball, a wall, and people to play with.

Drag the tiles to the correct boxes to complete the pairs.
Match the underlined phrase in each sentence to the type of phrase it contains.

adverbial phrase

noun phrase

verb phrase

Sentence Type of Phrase
He has been playing the cello at schools for ages.

We worked on the framework for a very long time.

Few people understood Michelle's exaggerated explanation.

Answers

Answer:

He has been playing the cello at schools for ages-Verb Phrase

We worked on the framework for a very long time.-adverbial phrase

Few People understood Michelles exaggerated explanation-Noun Phrase

Explanation:

I just took the test and got a 100% on edmentum/plato

English grammar uses a variety of phrase types. A phrase is a collection of words that the dictionary refers to as "a mental unit" (an idea contained in a few words).

What are phrases?

A phrase by itself is not a complete sentence. The crucial thing to remember is that sentences without a subject and predicate do not make sense on their own.

A noun phrase is a collection of words made up of the noun (or pronoun, such as he, she, or it) and other words that describe it.

A/an/the, quantifiers (some, a lot, a little), demonstratives (this, that, those), possessives (his, her, their), adjectives, and adverbs are examples of modifiers. Noun phrases are employed to provide additional context for a noun. They can serve as a sentence's subject, object, or complement.

Therefore, English grammar uses a variety of phrase types. A phrase is a collection of words that the dictionary refers to as "a mental unit" (an idea contained in a few words).

To learn more about phrases, refer to the link:

https://brainly.com/question/15806900

#SPJ2

Part One: Correctly put a period, exclamation point, or question mark after each sentence.

There are three days left
Their cat is black
Isn’t it Monday
Help, a clown is chasing me
Do you live in America
Homework is boring
I wonder what time it is
Did she do it
Wow
How many pickled peppers did he pick?
I am too tired
I wonder how far that bus goes
Are you sure that goes there?
I think this may be getting harder
I wonder when this will end

Put that down right now
Which one is yours
I don’t know which one is mine
Do you know how to do this
To whom should I give this
He does his homework; doesn’t he
Don’t shut the door
I’d hate to have not done my homework
Who cares
Africa is not a country; it’s a continent
Wherefore art thou, dear Juliet
There’s a big project due; isn’t there
Leave me alone
I wish I knew what time it was
What a fun assignment

Answers

Answer:

There are three days left.

Their cat is black.

Isn’t it Monday?

Help, a clown is chasing me!

Do you live in America?

Homework is boring.

I wonder what time it is.

Did she do it?

Wow!

How many pickled peppers did he pick?

I am too tired.

I wonder how far that bus goes.

Are you sure that goes there?

I think this may be getting harder.

I wonder when this will end!

Put that down right now!

Which one is yours?

I don’t know which one is mine.

Do you know how to do this?

To whom should I give this?

He does his homework; doesn’t he?

Don’t shut the door.

I’d hate to have not done my homework!

Who cares?

Africa is not a country; it’s a continent.

Wherefore art thou, dear Juliet?

There’s a big project due; isn’t there?

Leave me alone!

I wish I knew what time it was.

What a fun assignment!

Explanation:

tbh you could probably replace the periods and exclamation marks with each other and it'd still be correct with different connotation. keep that in mind

What does Cameron tutor Bianca in school?
O Latin
O German
O French
O Geometry

Answers

They study and learn French

Does Social Media platforms make real-world bullying worse?

Can someone help me answer this in a parents perspective (2,3+)

Answers

Answer:

yes

Explanation:

as a parent , we know how your child acts and talks and when theirs changes in that. even if child may think other wise. social media is used by many people to hide behind a screen and spread more gossip faster

Read the excerpt from "Sonnet 29.”

When, in disgrace with fortune and men's eyes,
I all alone beweep my outcast state,
And trouble deaf heaven with my bootless cries,
And look upon myself, and curse my fate,

What is the rhyme scheme of these lines?

abab
abba
abcb
abac

Answers

Answer:

abab

Explanation:

These lines in Sonnet 29's rhyme scheme give the sonnet rhythm, indicate the end of the lines, and create a pleasant reading experience  the rhyme scheme of these lines is abab, hence option A is correct.

What is a rhyme scheme?

There are various rhyme schemes that are constructed by placing the words that rhyme last and are sorted by the location in which they occur in the refrains.

The final expression of the main section eyes rhymes with the final expression of the third refrain cries in Sonnet 29, while the final expression of the subsequent stanza state rhymes with the final expression of the fourth refrain destiny. As a result, each stanza in the poem is separated by a comma.

Therefore, the rhyme scheme of these lines is abab, hence option A is correct.

Learn more about rhyme scheme, here:

https://brainly.com/question/14493007

#SPJ7

PLEASE I NEED HELP!!!!he purpose of the sensory language in this passage is to help readers o imagine what Johnny and his sisters look like understand how Johnny became so ill. experience how sick and frustrated Johnny feels. O picture what Johnny's room looks like.​

Answers

Answer:

C. Experiance how sick and Frustrated Johnny Feels

Explanation:

Thats the answer

what has malala learnt from gandi

Answers

Answer:

She learned the philosophy of non-violence from Gandhi.

Explanation:

PART A: Which of the following identifies the central idea of the text?

A. The Civil Rights Act of 1964 was notable for being the first major government action taken to address discrimination on the basis of race.

B. While state governments were overwhelmingly supportive of the Civil Rights Act of 1964, the federal government continued to obstruct the progress of any legislation.

C. The Civil Rights Act of 1964 successfully ended racial discrimination, but people continued to experience discrimination based on other identifying traits.

D. The important protections promised by Civil Rights Act of 1964 were the result of significant activism by advocates, as well as the leadership of elected officials.

Commonlit: The Civil Rights Act of 1964

Answers

Answer:

C

Explanation:

C

because it ended the racial discrimination

ANSWER NOW PLEASE
1.)Which of these is an example of competition?
B.)Spider builds a web between two plants
C.)Mushrooms gain nutrition from a tree trunk
D.)Crow and seagull try to snatch food from each other
E.)Cape buffalo gets cleaned up as oxpecker eats insects

random subject: English
actual subject: Science

Answers

Answer:

D

Explanation:

The two birds would be trying to find the same food so one of them would get it and one wouldn't.

what helped panyee football club be a success and why?

Answers

Answer:

What the heck is a Panyee then ill answer this piece of shot

Explanation:

My favorite flower is the rose. The predicate noun in this sentence is...​

Answers

Answer:

i think it may be ''FAVORITE''

Explanation:

Answer:

Rose

Explanation:

Hope this helps :)

Which passage is an example
of imagery?
A. Jim might be properly anxious about
the time in any company.
II.
B. There was no other like it in any of the
stores...
C. She was ransacking the stores for
Jim's present
NEED HELP ASAP

Answers

Answer:

C

Explanation:

imagery- descriptive language you can visualize

So you are looking for a sentence here, that you can see and imagine. When you read these, the only one that you can really see with your imagination, is C. Because you can imagine seeing her ransacking the stores. Going to each and every one looking for that present!

Hope this helps!

The correct answer would be C i think


Which of the following sentences uses adjectives and adverbs correctly?

Answers

Answer:

He works hardly.” (Correct: “He works hard.”) “She writes good.” (Correct: “She writes well.”)

PLEASE HELP ASAP
What are some financial choices I’lol have to make in the future for college and adult life?

Answers

Answer:

to save money and only spend it on things

Explanation:

Read any book and describe an interesting or important character in your book write 5 sentences

Answers

Answer:

I read a book called Five Feet Apart.

In this book, the lead male character is a boy called Will. He was diagnosed with Cystic Fibrosis and eventually got B. cepacia.

Will is a rebellious and disorganized boy, and he likes to draw cartoons.

He never really cared about life because he knew he couldn't be treated and he would die one day.

Then he met a girl named Stella, and she gave meaning to his life and in the end he risks his life to save her.

I think he is a very interesting character and showed big character development throughout the book.

Answer:

Okay well my favorite book is called the Gathering and the main characters are Mya, Raff, and Daniel. Mya's best friend had died in a lake from an unexpected drowning that nobody knows how.  Mya tries to figure out who is her real mother is, to figure out what the paw print birth mark means. Then at the end, she founds out that Raffs sister, Emily, Is a cougar with the same print as Mya. A forest fire begins...

Explanation:

Please help me ASAP with this problem

Answers

Answer:1.sentence fragmit

Explanation:

Answer:

Fragment

Explanation:

No comma, no run on words and no rambling. Therefore fragment, because you need the other part to understand.

how does having a friend make it easier to get through the bad times in life and make the good times even better

Answers

Answer: Having a friend makes it easier to get through the bad times in life and make the good times even better because friends are by your side no matter what. Friends play a significant role in promoting your overall health.

Your friends usually are trustworthy, loyal, and kind to you. They can make your day if you’re feeling down, or make your day even better.

Explanation:

Hopefully this is okay!

help real quick on this plzz

Answers

Answer:

To my understanding, it says on all 3 pages. You only included one page but if I misunderstood and they were asking for only the first page, then I'd say the second sentence of the second paragraph.

Explanation:

Which one is an economic incentive?

Speeding ticket
Time out
Stickers
Extra swimming time

Answers

Answer:

Extra Swimming Time

Explanation: In the most general terms, an incentive is anything that motivates a person to do something.

Other Questions
Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False