What gang has the best rappers in your opinion? I think it's the crips.

Answers

Answer 1

Answer:

this is not an academic answer

Explanation:

Answer 2

Answer:

I honestly dont know

Explanation: Some gangs have good rappers that shine out more than the rest. Its mostly opinion based because some people could say that the crips arent good. Also depends on the kind of rappers they like


Related Questions

Select the word that best completes the sentence.
The audience showed their
for the contestant by giving him loud applause.
O slander
o tolerance
O deception
o partiality

Answers

Answer:

The answer is partiality.

Explanation:

Partiality means a particular liking or fondness for something or favoritism. That makes sense in this sentence because it is a contestant and the audience clapped for him.

I hope this helped and if it did I would appreciate it if you marked me Brainliest. Thank you and have a nice day!

What did conductor say before the train sped away in polar express

Answers

Answer: The train is headed to the North Pole

Explanation:

Read the excerpt from The Story of My Life by Helen Keller.

Dr. Bell advised my father to write to Mr. Anagnos, director of the Perkins Institution in Boston, the scene of Dr. Howe's great labours for the blind, and ask him if he had a teacher competent to begin my education. This my father did at once, and in a few weeks there came a kind letter from Mr. Anagnos with the comforting assurance that a teacher had been found. This was in the summer of 1886. But Miss Sullivan did not arrive until the following March.

Which line from the excerpt shows the first-person point of view?

Dr. Bell advised my father to write to Mr. Anagnos
in a few weeks there came a kind letter from Mr. Anagnos
This was in the summer of 1886.
But Miss Sullivan did not arrive until the following March.

Answers

Answer:

Dr. Bell advised my father to write to Mr. Anagnos

Answer:

a

Explanation:

Can someone help please

Answers

Answer:

the picture is not clear copy and paste he questions so i can answer them.

Explanation:

copy and paste he questions so i can answer them.

Emmet Till's murder was one of many causes for social unrest and the Civil Rights Movement. Can you think of SIMILAR catalysts for social movements happening at that time or today? What do these events have in common? [Independent research is required]. Cite TEXTUAL evidence in your PARAGRAPH response.
I NEED THIS ASAP LIKE RN

Answers

Answer:

There was this recent murder of a young boy like Emmet Tills  Quawan Charles.

Explanation:

What are the personality traits for Bruno in the boy in the strip pajamas

Answers

Answer:

Bruno is the naive but perceptive main character of the story. He is dark-haired and small for his age. He thirsts for adventure and discovery, and this trait leads him toward transformation. Though he resists everything about his new home at Out-With initially, his love for his friend Shmuel changes his attitude.

Bruno is a very naive character albeit perceptive. He craves adventure and discovery but slowly changes through his interactions with Shmuel

Please Match the Terms for both.
Law and Court. Help ASAP, please.

Answers

Answer:

Below:

Explanation:

Page 1. Vocab Words. (Started with absolute)

1. D

2.B

3. I

4. A

5. E

6. G

7. H

8. C

9. F

10. J

Page 2. Criminal-Court Terms. (Started with judge)

1. D

2. G

3. E

4. I

5. J

6. H

7. F

8. B

9. C

10. A

PLEASE HELPPPPPPPPPPP

Answers

Answer:

9.D (passion), 10. A (ponder), 11. B (attack), 12. C (trade), 13. D (quality) 14. D (catching)

Explanation:

Those are synonyms of those words.

the good things of stunt job​

Answers

A stuntman typically performs stunts intended for use in a film or dramatized television. Stunts seen in films and television include car crashes, falls from great height, drags (for example, behind a horse), and explosions. There is an inherent risk in the performance of all stunt work


If an idea is restated in a nonfiction article, what does this most likely signal for the reader?

Answers

Answer:

It could be foreshadowing what could happen in the future or be trying to to show the reader this is an important idea and should he remembered.

Answer:

Explanation:

something the reader should think fell or do

How is the Odyssey the ultimate adventure story?

Answers

The Odyssey is not only a great romantic, adventure epic, but it's terribly realistic in its depiction of human nature and a brilliantly crafted narrative. Authors today could learn from how Homer lays out his plot and plays the characters off against each other for maximum reader involvement.

It’s an amazing book because of the things him and his crew go through while his trip

what contributes to the economy​

Answers

Answer:

shopping

Explanation:

basically anything that has to do with you giving money to someone else.

Answer:

Economists generally agree that economic development and growth are influenced by four factors: human resources, physical capital, natural resources and technology. Highly developed countries have governments that focus on these areas.

brainliest plz!

22. Develop a story with the help of the following outline. Suggest a suitable title and a moral
too:
Two goats - narrow bridge - come from two opposite directions - both want to pass at the
same time - both reach in the middle of the bridge and say 'let me go first' - both remain
standing for minutes - both get angry and fight - both fall into the river and die - moral
(Source: S.L.C Payers, SC Paard of None C Set​

Answers

Answer:

Explanation:

There were once two goats, neither of which had much patience, or much willingness to compromise. This inherent stubborness would only lead to their ultimate downfall.

One day, the two passed each other on a very narrow bridge, while on an afternoon trek. Both demanded that they deserved to cross first, unable to compromise and only thinking of themselves.

After bickering for minutes on who deserved the first right of passage, the two began fighting. As one goat began to shove past the other, his hoof hit a unstable ledge on the bridge and he began to falter. The other, unwilling to let the other goat pass, confronted the goat, and then stepped on the same unstable ledge. The bridge then gave way, and the two goats  tumbled off the bridge, into the river, to their collective death.

The moral of this story are that patience, compromise, and teamwork are the keys to success.

Answer:

two goats........narrow bridge ......... come

What is the best response to this claim, "The first pest the United Nations should get under control is the mosquito."

Answers

Answer:

I would respond with, "Why do you feel this way?"

Explanation:

Answer:

What are the options

Explanation:

IReady Question



What is the author's purpose for writing this text?
A. To convince readers that practical skills should be taught in school
B. To warn readers that they may lack the skills necessary for work
C. To help readers develop some basic and valuable life skills
D. To persuade readers to spend more time listing their skills​

Answers

Answer:

To convince readers that practical skills should be taught in school

Explanation:

got it correct on I-Ready

list any four strenght for successful life?​

Answers

Answer: Be authentic. Be yourself. ...

Be truthful. There is nothing of greater significance to offer your life or business than honesty. ...

Challenge yourself. In order to make the most of your life and career, challenge yourself. ...

Put love first. ...

Be thoughtful

Explanation:

Hope this helped

Answer:

Develop Mental Toughness

Write an argumentative essay for or against always telling the truth, even in situations that may be hurtful to others.


Doesn't have to be to long, just a pre-write please!

Answers

Answer:

ok ill try

Explanation:

Telling the truth can be very helpful for you and for future situations. Lying can get you into a lot of trouble. Little lies can also turn into big lies that never end. Even if it is hard to tell the truth in some stressful situations, you should. It will make people think of you as a trustworthy and loyal person. Some people might think that its ok to tell a little lie to not be hurtful. You can still tell the truth and phrase it in a way that won't be hurtful. Its selfish to lie in any situation.

Hello! please help I will give brainliest

Answers

Answer:

The answer is C

Explanation:

Guys please answer these questions!!! I really need them pleasee!! no goggle answer pls

Answers

Answer: for  #2 you should put: The difference between  food , bolus and chyme is Food is what you consume to go into the digestive system. Bolus is a small rounded mass of a substance of chewed food before you swallow the food.  Chyme is a semi-fluid pulp that is in the stomach  that is  mostly made of partly digested food and the liquids of the gastrointestinal tract. The similarities that they have are that they all help the process for when your body is breaking down the food you are consuming.

For  #3 you should put : The process of the digestive system is, When you first put the food into your mouth ,You obviously chew to break down the food but also your saliva helps you to break down the food before you swallow too. When the food is swallowed it goes through your throat and from there the food travels to the esophagus AKA the swallowing tube.  The esophagus is a muscular tube traveling from the pharynx to the stomach. With a series of contractions, called peristalsis, and then  the esophagus delivers food to the stomach. Just before the connection to the stomach is made, there is a "zone of high pressure," called the lower esophageal sphincter; this is  meant to keep food from passing backwards going into  the esophagus.  The stomach is a sac-like organ with strong muscular walls. In conclusion  to holding the food, it's also a mixer and grinder. The stomach produces  acid and powerful enzymes that continue the process of breaking down the food. The small intestine  is made up of three segments, the duodenum, jejunum, and ileum, the small intestine is a long tube very loosely coiled in the abdomen. The small intestine continues the process of breaking down food by using enzymes released by the pancreas and bile from the liver.

For #4 you should put: If the Salivary glands were to be damaged, it would  make chewing and swallowing very difficult for you cause your mouth would be dry  and you would also have an increase risk of tooth loss and and infections and decay in the mouth.

Plz mark brainliest if these answers have helped you~

Explanation:

Many argue that GPS technology is harmful because it:
A. is expensive and difficult to navigate.
B. violates people's privacy and personal space.
C. shows us places we've never visited.
D. will get people lost because it's unreliable.

Answers

Answer:

B. Violates people's privacy and personal space

Explanation:

Which statement compares two items?
A. To escape the whirlpool, the fish would have to swim faster.
B. A black hole works something like that whirlpool.
C. Closer to the center of the whirlpool, the pull would grow stronger.
D. If the fish couldn’t go much faster, it would be swept away.

Answers

Answer:

b. A black hole works something like that whirlpool

Explanation:

The statement that compares two items is, A black hole works something like that whirlpool.

What is compares?

Compare means differentiate between two things.

Because a compare statement is which hold the two quality that is being compared. And in the statement a black hole works something like that whirlpool. A black hole which is in space is being compared with whirlpool, which is in water.

Hence the correct option is, B. A black hole works something like that whirlpool.

To know more about compares:

https://brainly.com/question/123818

#SPJ2

The support for your second thesis point should be discussed in which sentences in a 3.8 paragraph?

Answers

Answer:

There should be more to the question like a thesis attached to it?

Explanation:


How does critic Jason Kass support his claim that the high-tech toilet will not be as effective as
people might think?
2
A
by arguing that the high-tech toilets will be too expensive
B
by highlighting how the high-tech toilets will not last very long
of a high-tech toilet in one of these communities.
ane systems get clogged? Or if the supercritical
arbonization tank leaks, or worse, explodes? [...] If
Ets of the past 60 years have taught us anything, it's
do not work
Lloyd Alter slams the latest version of the toilet as
ve all, disseminates some of the West's most
include sitting on a toilet rather than squatting, a
the bowels, and placing toilets inside of
lets in Japan, which are more sanitary since
nd as Kass mentions, servicing such a
ined specialists that these communities) cannot
С
by pointing out that there is a lack of interest in the community in having the high-
tech toilets
D
by suggesting that engineers have not thought through the maintenance of the
high-tech toilets
<

Answers

Answer:

A

Explanation:

It says it in the article

Critic Jason Kass support his claim that the high-tech toilet will not be as effective as  people might think:

A . by arguing that the high-tech toilets will be too expensive

According to the criticisms made by Jason Kass, he mentioned that the plan of Bill Gates to build high-tech toilets was unreasonable as it would be too expensive to own.

He clearly stated that a vast majority of the people without access to a toilet were poor and could not afford thhe exorbitant fees needed to get such a high-tech toilet.

Therefore, the correct answer is option A

Read more here:

https://brainly.com/question/18859798


Which sentence provides the clearest sense of a story's setting?

A. Olga turned to the index of the book to find any mention of the
Great Depression.

B. Waves of nausea swelled from my core, making me feel like I
wanted to vomit.

C. "What I'm asking you for," said Rick, "is $100,000 for 5 percent of
the company."

D. The hull of the submarine groaned, yet the captain insisted that we
keep descending

Answers

Answer: D.) The hull of the submarine groaned, yet the captain insisted that we keep descending.

Explanation: just took the test!

The hull of the submarine groaned, yet the captain insisted that we keep descending. Therefore, the correct option is option D.

What is sentence?

A sentence is indeed a collection of words used to express a thought. A sentence always begins with such a capital letter then concludes with a period, punctuation mark, and exclamation point. Ideal sentence construction has a verb and a subject. Declarative sentences make a declaration, express an opinion, or make an emotion known.

Declarative sentences have a period at the end. Questions are asked in sentences known as interrogatives. These phrases are followed by a question mark. This kind of phrase is used to give instructions or make a request. There is typically a period at the end, but occasionally there is also an exclamation point. Univocal means having only one possible meaning.  The hull of the submarine groaned, yet the captain insisted that we keep descending. This provides the clearest sense of a story's setting.

Therefore, the correct option is option D.

To know more about sentence, here:

https://brainly.com/question/22794143

#SPJ7

11. If you
(study) hard, you
(be) a good student
12.If it
(rain), you
(get) wet
13.If you
(mix) red and yellow, you
(get) orange.
14.If he
(work) a lot, he
(earn) a lot of money,
15.If she
(wear) a blue dress, she
(look) great.​

Answers

Answer:

I agree I like this little message

HELP MEEEE PLEAAASSSEEEEEEEEE When it comes to life and nature, Jack London and Robert Frost have _________.

different perspectives
various things that they agree upon but others that they do not
similar points of view
nothing in common because they are from different areas of the country
also, can I get an explanation so I know ur not guessing

Answers

Answer: similar names

Explanation: they have similar name but are still different and thats why their perspectives are different.

I will make you brainliest if you get this riddle right.

The barber of Seville shaves all men living in Seville.
No man living in Seville is allowed to shave himshelf.
The barber of Seville lives in Seville.
But who shaves the barber of Seville?​

Answers

Answer:

a woman no man live in selvile is allowed

Explanation:

Read the following excerpt from “Raymond’s Run” and answer the question.

So I’m strolling down Broadway breathing out and breathing in on counts of seven, which is my lucky number, and here comes Gretchen and her sidekicks…
What is the meaning of the word "sidekicks" as it is used in this passage?

close friends
breathing exercise
kicking exercise
enemies

Answers

The answer is Close friends

'close friends' ofc!

Write a 5 Paragraph Essay on “How people can learn to be kinder to one another”.

Answers

Answer:

Recognize that your self-talk can be the fuel on a raging negative fire. Have a plan for positive action. Don’t be a hater on social media or anywhere else. Walk away from negative thoughts and negative people. Do something nice for someone, even if you think they don’t deserve it.

is of unconventional and surprisingly modern flying machines. a phrase or a clause

Answers

Answer:

phrase

Explanation:

The statement "Is of unconventional and surprisingly modern flying machines" is simply a phrase.

What is a phrase?

It should be noted that a phrase simply means a group of words that stand together as a conceptual unit.

In this case, statement "Is of unconventional and surprisingly modern flying machines" is simply a phrase.

Learn more about phrase on:

https://brainly.com/question/1877100

#SPJ2

Other Questions
4. Discuss the role of necrohormones Let f(x) = 9x and g(x) = x + 7. What'sthe smallest number that is in the domain offg?Enter the correct answer.OOOODONEClear all what was the strength and weakness of Adam Smith and David recardo A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest?