what do the chomosomes of the cell before mieosis ii look like a) same number of chromosomes but different alleles in each cell

Answers

Answer 1

The chromosomes of the cell before meiosis ii look like this- The cells are haploid — have only one chromosome from every homolog pair — however, their chromosomes actually comprise of two sister chromatids.

Cells move from meiosis I to meiosis II without replicating their DNA. Meiosis II is a more limited and less complex cycle than meiosis I.

In meiosis II, the sister chromatids are discrete, making haploid cells with non-copied chromosomes. During prophase II, chromosomes gather and the atomic envelope separates, if necessary. The centrosomes move separated, the axle structures among them, and the spindle microtubules start to catch chromosomes.

Know more about meiosis II here: https://brainly.com/question/29383386

#SPJ4


Related Questions

What is the specific purpose of mitosis 1?

Answers

Mitosis divides the genome in order to give the two daughter cells an identical genome and an equal number of chromosomes.

Describe the mitosis.

During the mitotic phase, a single cell divides into two identical daughter cells (cell division)

Cell division is the splitting of a single cell into two new cells.

The number of chromosomes in daughter cells is equal to that of the parent cell.

Mitosis occurs for a reason:

In multicellular eukaryotes, the zygote rapidly divides during mitosis to create the embryo, whereas mitosis serves as an asexual reproduction process in single-celled eukaryotes.

Visit this link to find out more information on Mitosis:

https://brainly.com/question/9809645

 #SPJ4

What is the most painful part to get a tattoo?

Answers

Ribcage is the most painful part to get a tattoo.

The rib cage is one of the most painful places to receive a tattoo. Because of the excruciating discomfort, many people who had their entire torso tattooed referred to it as the most painful part of all. The skin around the ribs is often extremely thin, and the needle actually penetrates the region. Furthermore, it is a delicate subject.

Because the rib cage shifts when we breathe, tattooing becomes more difficult for the tattoo artist and more uncomfortable in the process - make sure you request lots of pauses. One of the most painful places, the rib cage, is ranked 9 for both men and women.

learn more about tattoo at https://brainly.com/question/24100297

#SPJ4

What does the farmhouse in Animal Farm represent in the Russian Revolution?

Answers

Animal Farm, proverbial at the start and also the finish of the novel because the Manor Farm, symbolizes Russia and also the land beneath political party rule.

However a lot of typically, Animal Farm stands for any human society, be it capitalist, socialist, fascist, or communist. It possesses the interior structure of a nation, with a government , a personnel or army , a labour , and state holidays and rituals. Its location amid variety of hostile neighboring farms supports its symbolism as a political entity with diplomatic considerations.

The barn at Animal Farm, on whose outside walls the pigs paint the Seven Commandments and, later, their revisions, represents the collective memory of a contemporary nation.

The great windmill symbolizes the pigs’ manipulation of the opposite animals for his or her own gain.

To learn more about  Russian Revolution :

https://brainly.com/question/29760197

#SPJ4

Is atherosclerosis an autoimmune disease?

Answers

Furthermore, it is becoming more and more evident that atherosclerotic CVD, which is now recognized as an inflammatory autoimmune illness, is influenced by chronic inflammation and immunological dysregulation.

Atherosclerosis is accelerated in autoimmune rheumatic disorders, which results in cardiovascular disease.Preclinical atherosclerosis testing is available for some types of the disease.The immune system's cellular and humoral components are implicated in the development of atherosclerosis.In autoimmune rheumatic illnesses, both traditional and novel atherosclerotic risk factors are linked to accelerated atherosclerosis.In experimental models, atherosclerosis can be immunomodulated in a variety of ways, including by inducing immunological tolerance.

Learn more about atherosclerosis to visit this link

https://brainly.com/question/29626891

#SPJ4

for which organic compounds must information be encoded in dna for green plants to synthesize the other three compounds? select one: a. starches b. proteins c. fats d. sugars

Answers

Organic compounds are the building blocks of life and are essential for living organisms. They provide the necessary energy, structure, and functions for life to exist. In green plants, four main organic compounds must be encoded in DNA for the plants to synthesize the other three compounds. These four compounds are starches, proteins, fats, and sugars.

Starch is a polysaccharide composed of glucose molecules and is the main energy source for green plants. Proteins are complex molecules made up of amino acids. They are essential in the structure and function of cells and are responsible for many of the plants’ metabolic functions. Fats are made up of glycerol and fatty acid molecules and are an important source of energy for plants. They are also important in providing structure to the plants’ cells.

Sugars are simple carbohydrates composed of glucose molecules. They are a primary source of energy for green plants and provide the necessary sugars needed for photosynthesis. The information for synthesizing sugars must be encoded in the plants’ DNA in order to create the necessary enzymes and proteins needed in the chemical reaction.

Learn more about polysaccharide at : https://brainly.com/question/16580858

#SPJ4

What is the largest fruit crop in the world?

Answers

Tomatoes is the largest fruit crop in the world because they produced in a larger quantities than any other fruit with more than 170 million tons grown internationally each year.

What is fruit crop?

Fruit crops can be defined as the part of flowering plants that produce the seeds as food. Some of the benefits of fruit crops is that they supply vitamins and mineral to the body, they aid food digestion and they protect body and prevent body from ill – health.

Therefore Fruit crops represent a wide range of woody perennial species cultivated in orchards where soils vary greatly in their biological, chemical and physical properties.

Learn more about fruit crop here: brainly.com/question/887181

#SPJ1

COVID-19 is a disease-causing severe pneumonia in patients infected by _______________.
A. Yersinia pestis
B. SARS-CoV-1
C. SARS-CoV-2
D. BatCoV RaTG13

Answers

A COVID pneumonia is an infection of the lungs brought on by the COVID-19 virus, SARS-CoV-2. Pneumonia can develop as a side effect of having COVID-19. Your lungs become inflamed and swollen as your immune system fights the infection there, making it difficult to breathe.

Almost usually, the COVID-19-related pneumonia affects both lungs simultaneously (bilateral). The interstitial tissue that lines the air sacs, blood veins, and airways in your lung. Scarring or other lung damage is a result of interstitial lung disease. In COVID-19, bilateral interstitial pneumonia refers to pneumonia caused by the virus that results in lung destruction on both sides. This often transpires following the first (infectious) stage, frequently in individuals with protracted COVIDs (post-acute sequelae of SARS CoV-2, or PASC).

Learn more about COVID-19 here

https://brainly.com/question/28908700

#SPJ4

What is a good thesis statement for coral reefs?

Answers

A good thesis statement for coral reefs is that the most colourful living things in the ocean are coral reefs.

Reef corals safeguard our coastlines, provide homes for many marine animals, and support a healthy ocean food chain.

Coral polyps build the enormous limestone structures known as coral reefs. Coral reefs, sometimes referred to as the "rainforests of the sea," are home to about 25% of all known marine species.

An underwater environment known as a coral reef is characterised by corals that construct reefs. Reefs are constructed by coral polyp colonies that are connected by calcium carbonate.Stony corals, whose polyps gather together, make up the majority of coral reefs.

Coral reefs support local economies, provide opportunities for recreation, and act as a barrier against erosion and storm damage. They are a source of both fresh food and medicines. Reefs are essential for the safety, livelihood, and nourishment of more than 500 million people.

Learn more about Coral polyps from:

https://brainly.com/question/7169839

#SPJ4

vibrio cholerae is a human pathogen that causes cholera. it has an unusual shape distinctive of its genus. considering that it does not have one of the most common bacterial shapes, what is the shape of this species?

Answers

Vibrio cholerae is a human pathogen that causes cholera, the shape of this species is curved rod shaped.

Cholera is a potentially fatal secretory diarrhea characterized by many, copious watery feces, frequently accompanied by vomiting, and culminating in hypovolemic shock and acidosis.

It is caused by members of the Vibrio cholerae species, which can also produce mild or inapparent infections. Other members of the species may produce localized outbreaks of milder diarrhea on occasion, although the great majority are free-living and unaffected by illness.

Vibrios are Gram-negative curved rods with a single polar flagellum that are highly motile. They can withstand alkaline medium, which kills most intestinal commensals, but they are acid sensitive. There are several free-living vibrios, some of which are potentially harmful.

Cholera is spread by the fecal-oral route. Vibrios are acid-sensitive organisms that perish in the stomach. Surviving pathogenic organisms may cling to and populate the small intestine, where the highly lethal cholera enterotoxin is released (CT, also known as "choleragen"

This toxin binds to the plasma membrane of intestinal epithelial cells, releasing an enzymatically active component that increases cyclic adenosine 51-monophosphate production (cAMP). An increase in intracellular cAMP causes massive electrolyte and water release into the intestinal lumen.

Learn more about Vibrio cholerae at  https://brainly.com/question/28808687

#SPJ4

Chapter 17 The Female Reproductive System

Answers

The female reproductive system includes the ovaries, the fallopian tubes, the uterus, the cervix, and the vagina.

The internal and exterior sex organs that are part of the female reproductive system play a role in the conception of new offspring. The female reproductive system in humans is immature at birth and matures to produce gametes and carry a foetus to term during adolescence.

Vagina: The vagina is a muscular tube that accepts the male reproductive organ during sexual activity and serves as the baby's exit from the uterus during birthing.

Uterus: If an egg was properly fertilised, this organ houses and sustains a growing foetus.

Ovaries: The ovaries are the female gonads that create oocytes.

Learn more about ovaries from:

https://brainly.com/question/22265015

#SPJ4

3. In the diagram of a cell below, the structure
labeled X enables the cell to
2
(1) release energy
(3) control cell activities
(2) store waste products (4) manufacture proteins
4 If the ribosomes of a cell were destroved whatsoever

Answers

Label x = store waste products
If the ribosomes in the cell were destroyed the cell would not be able to grow (growth and repair)

Answer:

Explanation:

In the diagram you provided, the structure labeled X is the endoplasmic reticulum (ER). The endoplasmic reticulum is a network of flattened sacs and tubes that is found within the cytoplasm of eukaryotic cells (cells that have a nucleus and membrane-bound organelles).

There are two main types of endoplasmic reticulum: the rough endoplasmic reticulum (RER) and the smooth endoplasmic reticulum (SER). The rough endoplasmic reticulum is studded with ribosomes, which are small organelles that synthesize proteins. The smooth endoplasmic reticulum, on the other hand, does not have ribosomes attached to it.

The endoplasmic reticulum plays several important roles in the cell, including:

1. Release of energy: The endoplasmic reticulum is involved in the synthesis of lipids and the breakdown of carbohydrates, which releases energy that can be used by the cell.

2. Control of cell activities: The endoplasmic reticulum helps to regulate the synthesis and transport of proteins and lipids within the cell.

3. Storage of waste products: The smooth endoplasmic reticulum is involved in the synthesis and detoxification of certain substances, such as drugs and hormones.

4. Manufacture of proteins: As mentioned, the rough endoplasmic reticulum is involved in the synthesis of proteins. Proteins are synthesized on the ribosomes attached to the RER and are then transported into the lumen (cavity) of the RER for further processing and modification.

If the ribosomes of a cell were destroyed, the cell would no longer be able to synthesize proteins, which would severely impact its function and survival.

When two pea plants that are heterozygous for color are crossed what ratio or percentage are yellow?

Answers

Phenotypic ratios is 1:0 yellow : green of genotypes produced in the example of crossing a heterozygous yellow pea with another heterozygous pea ratio of phenotypes.

What do you mean by offspring?

The term offspring has been refers to the young innovation of the living beings. That particular organism has been assembled either by an individual organism or, in the topic of physiological property, reproduction between the two organisms.

The main reason for this is that the offspring of the living creature will have one parent trait or the other parent trait, but they do not blend or mix together, such as when two plants are tall and the other is short; the children will be tall or short, but not medium size.

Therefore, Phenotypic ratios is 1:0 yellow : green of genotypes produced in the example of crossing a heterozygous yellow pea with another heterozygous pea ratio of phenotypes.

Learn more about Phenotypic ratios on:

https://brainly.com/question/11552649

#SPJ4

The coagulation cascade controls blood clot formation in response to blood vessel injury. Thrombin is an enzyme that plays a key role in regulating the coagulation cascade. A simplified model of thrombin’s role in regulating the coagulation cascade is represented in Figure 1.
Argatroban is a competitive inhibitor of thrombin. Which of the following effects on the coagulation cascade is most likely to result from inhibiting thrombin activity with argatroban?

answer choices
The activation of clotting factors will be blocked.
The rate of fibrin formation will decrease.
Thrombin will be converted to prothrombin.
The rate of blood clot formation will increase.

Answers

The rate of fibrin formation will decrease. So, the correct option is (B).

What is Coagulation cascade?

The coagulation cascade is also known as secondary hemostasis. It is defined as the series of steps in response to bleeding that occurs due to tissue injury, where each step activates the next and finally leads to the formation of a blood clot. The word hemostasis is derived from "hem-", meaning "blood", and "-stasis", meaning "to stop".

Hemostasis has two phases where primary hemostasis forms an unstable platelet plug at the site of injury after which the coagulation cascade is activated to stabilize the plug, stop blood flow and allow increased time for necessary repairs to take place Is. This process reduces blood loss after injuries. The rate of fibrin formation will decrease which effects on the coagulation cascade is most likely to result from inhibiting thrombin activity with argatroban.

The coagulation cascade involves the activation of a series of clotting factors, which are proteins involved in blood clotting where each clotting factor is a serine protease which is a type of an enzyme that triggers the breakdown of another protein. Clotting factors are initially in an inactive form called zymogens.

Thus, the rate of fibrin formation will decrease. So, the correct option is (B).

Learn more about Coagulation cascade, here:

https://brainly.com/question/28215877

#SPJ4

What enzyme is broken down in the stomach?

Answers

Amylase (produced in the tongue and pancreas; breaks down complex carbs) (made in the mouth and pancreas; breaks down complex carbohydrates).

Lipase (produced in the pancreas; breaks down fats) (made in the pancreas; breaks down fats) Protease (produced in the pancreas; breaks down proteins) (made in the pancreas; breaks down proteins).

The six stages of digestion include ingestion, propulsion, mechanical digestion, chemical digestion, absorption, and feces.

The stomach lining's glands produce digestive enzymes and stomach acid. Your stomach's muscles mix the meal with these digestive liquids. Pancreas. An enzyme-rich digestive fluid that is produced by your pancreas can break down proteins, lipids, and carbohydrates.

For more information on digestion in stomach kindly visit to

https://brainly.com/question/28301845

#SPJ4

What is the name of the process that converts mRNA → amino acid?

Answers

Translation is the name of the process that converts mRNA → amino acid.

Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make proteins after the process of converting DNA to RNA in the cell's nucleus, as defined by molecular biology and genetics. Gene expression refers to the entire process.

The process of translating mRNA into the chain of amino acids that makes up the produced protein occurs on ribosomes in the cytoplasm of the cell. The ribosome is a complex molecule made up of numerous ribosomal RNA molecules, numerous proteins, and both tiny and big subunits. Initiation, elongation, and termination are the three phases of an mRNA molecule's translation by the ribosome.

To learn more about translation of proteins, here

https://brainly.com/question/16305501

#SPJ4

the different finch species found on the galápagos islands probably arose as a result of _____.

Answers

Answer:

The different species of finches found on the Galapagos Islands probably arose as a result of evolution.

Which are characteristics of a prokaryotic cell? select three options. Contains dnalacks dnacontains ribosomeslacks ribosomescontains a nucleuslacks a nucleus.

Answers

Answer:

Prokaryotic cells lack a nucleus surrounded by a complex nuclear membrane and generally have a single, circular chromosome located in a nucleoid.

Explanation:

Eukaryotic cells have a nucleus surrounded by a complex nuclear membrane that contains multiple, rod-shaped chromosomes. [1] All plant cells and animal cells are eukaryotic.

What is a point mutation quizlet?

Answers

Point Mutation is a mutation in which a single pair of nucleotides in a certain point in the gene sequence is affected.

A point mutation is a genetic mutation that occurs when a single nucleotide base in an organism's genome is changed, inserted, or deleted. Point mutations have a variety of effects on the downstream protein product, with moderately predictable consequences based on the specifics of the mutation. In terms of protein production, composition, and function, these consequences can range from having no effect (e.g., synonymous mutations) to having a negative effect (e.g., frameshift mutations).

Transitions occur when a purine base is replaced with another purine or a pyrimidine is replaced with another pyrimidine. Transversions occur when a purine is replaced by a pyrimidine or vice versa. Missense mutations result in the production of a different amino acid. A missense mutation, also known as a non-synonymous change, alters a codon to produce a different protein.

The term point mutation is sometimes used to describe insertions or deletions of a single base pair (which has a greater negative effect on the synthesised protein because the nucleotides are still read in triplets, but in different frames: a mutation known as a frameshift mutation).

To learn more about point mutations, here

https://brainly.com/question/14364090

#SPJ4

Lewis is running in a race. His muscles need oxygen. Which best describes how multiple systems interact to bring him into homeostasis?

The circulatory system brings oxygen to the respiratory system, which delivers oxygen to the muscular system.
The respiratory system brings oxygen to the circulatory system, which delivers oxygen to the muscular system.
The respiratory system brings oxygen to the circulatory system, which delivers oxygen to the skeletal system.
The circulatory system brings oxygen to the respiratory system, which delivers oxygen to the skeletal system.

Answers

Answer:

The circulatory stem brings oxygen to the respiratory system, which delivers oxygen to the muscular system.

Explanation: Hope this helps! :)

How many genes did the human genome project find?

Answers

The primary goals of the Human Genome Project (HGP), which lasted from 1990 until 2003, were to determine both the DNA sequence and “the location of the estimated 100,000 human genes.

The Human Genome Project (HGP) was a worldwide scientific research effort that aimed to discover the base pairs that make up human DNA as well as to identify, map, and sequence every gene in the human genome from both a physical and functional perspective.

The project began in 1990 and was finished in 2003. It continues to be the biggest collaborative biological endeavor in the world.  Planning began after the US government adopted the concept in 1984, the project was formally begun in 1990, and it was virtually finished on April 14, 2003, but only comprised around 85% of the genome.

Learn more about  Human Genome Project (HGP) to visit this link

https://brainly.com/question/1897633

#SPJ4

What are the starting products of light-independent reactions?

Answers

The starting of the light-dependent reaction is called the Calvin cycle.

The Calvin cycle is a cycle that is also called the C3 cycle. It is the cycle of chemical reactions that binds carbon from the carbon cycle to sugars. It is found in the chloroplasts of plant cells. Calvin cycle reactions is divided into three main stages, They are Carbon fixation, reduction, and regeneration of the parent molecule. The function of the Calvin Cycle is to create three-carbon sugars that plants can use to build other sugars such as glucose, starch, and cellulose that they use as structural building materials. The Calvin Cycle takes carbon molecules directly from the air and turns them into plant matter. This is the starting product of light-dependent reactions.

Learn more about the Calvin cycle in

https://brainly.com/question/3199721

#SPJ4

What happens during the carbon fixation stage?

Answers

The first stage of the Calvin cycle is carbon fixation. In order to create two molecules of 3-PGA, the enzyme RuBisCO fixes CO₂ to RuBP.

In the process of carbon fixation, the five-carbon acceptor molecule ribulose-1,5-bisphosphate joins forces with the carbon dioxide molecule RuBP. This process creates 3-phosphoglyceric acid, a six-carbon substance that divides into two molecules of a three-carbon compound 3-PGA. The RuBP carboxylase/oxygenase enzyme, often known as rubisco, is the catalyst for this reaction. In plants, stomata, or pores on the surface of the leaf, allow atmospheric carbon dioxide to enter the mesophyll layer of the leaves. The chloroplast stroma and mesophyll cells can both absorb it at that point.

Hence, carbon dioxide combined with RuBisCO to form 3-PGA.

To know more about Stomata.

https://brainly.com/question/27780594

#SPJ4

List the significant events of the light-independent reaction (Calvin Cycle). Include which reactants and products are involved. Highlight what will be released as a product. Be sure to include where the process occurs in the chloroplast.​

Answers

Explanation:

there are two stages of Photosynthesis:

the light dependent stage: In this stage light energy is trapped using chlorophyll from the chloroplast. this light energy is used to separate water molecules(H2O) that were absorbed by the roots into Hydrogen and oxygen. the oxygen produced from this separation is then let off as a waste product.the light independent stage: the Hydrogen produced from the previous stage bonds with Carbon Dioxide(CO2) that diffused through the stomata from the atmosphere in order to form the plants food, which is in the form of glucose(C6H12O6)

light dependent equation:

2H2O + (trapped light energy) --> 2H2 + O2

light independent equation:

6CO2 + 6H2O --> C6H12O6 + 6O2

Learning through Art: Human Pedigree Analysis Can you identify the genotypes in this human pedigree for deafness? The human pedigree shown here is for an inherited form of deafness caused by a recessive allele (d). Drag the labels to the pedigree to identify the genotypes of individual family members. If you can't tell with certainty whether an individual is homozygous dominant or heterozygous dominant for the trait, place the label "DD or Dd" in that box.

Answers

Learning through Art: Human Pedigree the genotypes in this human pedigree shown here are homologous chromosomes, gene locus, recessive allele, centromere, sister chromatids, alleles, and dominant allele.

One chromosome from the mother and one from the father are often inherited in a pair. Homologous chromosomes, for instance, are two copies of Chromosome 1 in a cell.

Each gene has two copies, one from each parent, and they are each found at a distinct locus (place on a chromosome). However, the copies are not always the same. Gene copies that differ from one another are referred to as alleles.

When a cell divides, the centromere, which has a similarity with a constrictive area of a chromosome, is crucial in assisting DNA division (mitosis and meiosis). To be more precise, it is the area where the cell's spindle fibers are attached.

To learn more about chromosomes

https://brainly.com/question/1596925

#SPJ4

Are wood frogs Endotherms or Ectotherms?

Answers

Wood frogs are Ectotherms.

The ability of wood frogs to hibernate during the winter and remain dormant permits them to inhabit a large geographic range, reaching all the way from the Arctic to the Southeast of the United States. Wood frogs are referred to as the "coyotes of the amphibian world" by Mari Reeves, a researcher with the United States Fish and Wildlife Service who has conducted considerable research on the species in Alaska.  However, despite their adaptations, wood frogs are particularly susceptible to stressors such as the contamination of water and the effects of climate change. In order to successfully complete their life cycle, wood frogs, like all other amphibians, must spend time in both aquatic and terrestrial environments.

Want to know more about frogs visit the link which is given below;

https://brainly.com/question/3505647

#SPJ4

What adaptations do clams have?

Answers

(hope this helps, please mark me brainliest)

Learning through Art: DNA Structure doute Tento nea uchando Fra le

Answers

DOUBLE HELIX is a twisted-ladder shape of DNA, formed by two nucleotide  twisted around each other.

PHOSPHATE GROUP This is attached to the 5' carbon of the sugar unit.

One nucleotide of a DNA molecule consists of a phosphate group. There is formation of phosphate backbone it is the portion of the DNA double helix that provides structural support to the molecule.

DEOXYRIBOSE: This is a A five-carbon sugar that is a component of DNA nucleotides.

HYDROGEN BOND:
Hydrogen bonds are found between the bases of the  strands of nucleotides. Adenine forms hydrogen bonds with thymine whereas guanine forms hydrogen bonds with cytosine.

BASE PAIR: Two nitrogen-containing bases (or nucleotides) that pair together to form the structure of DNA is called base pair.

So these are  nucleotides on opposite strands of the DNA double helix.

NUCLEOTIDE: Nucleotide is one of the structural components, or building blocks, of DNA and RNA. It consists of a nitrogenous base (one of four chemicals: adenine, thymine, guanine, and cytosine) a molecule of sugar (deoxyribose or ribose) and a phosphate group.

NITROGENOUS BASE: Nitrogenous base is the carbon ring structure found in DNA or RNA binding of these base pairs forms the structure of DNA that includes adenine, guanine, cytosine, thymine, and uracil.

To learn more about DNA Structure
https://brainly.com/question/29634357
#SPJ4

An electric power plant manages to transfer 76% of the heat produced in the burning of fossil fuels to steam. Of the heat carried by the steam, 45 % is converted to mechanical work of the spinning turbine. Which best describes the overall efficiency of the heat-to-work conversion of the plant?.

Answers

If the heat is carried by the steam, 45 % is converted to mechanical work of the spinning turbine. the overall efficiency of the heat-to-work conversion of the plant is less than 45% efficient.

The degree to which heat is actually converted into mechanical work is referred to as the efficiency of the conversion.

76% of the problem's heat was turned into steam.

Consider the amount of heat produced by the fossil fuel as "x."

which means out of x, 76x/100 became heat, indicating that 0.76x is steam.

The question also says that 45 percent of the steam was used for mechanical work. which entails;

45/100 × 0.76x was converted to work,

which is equal to 0.342x

that is 34.2% of x.

Therefore the overall efficiency of the heat-to-work conversion of the plant is 45%

Know more about heat and work here: https://brainly.com/question/15864425

#SPJ4

(complete question)

An electric power plant manages to transfer 76% of the heat produced in the burning of fossil fuels to steam. Of the heat carried by the steam, 45 % is converted to mechanical work of the spinning turbine. Which best describes the overall efficiency of the heat-to-work conversion of the plant?

greater than 76% efficient

76% efficient

45% efficient

less than 45% efficient

How does oxygen levels relate to the rate of photosynthesis?

Answers

Oxygen production and the rate of photosynthesis are directly related. This means that as the rate of photosynthesis increases, more oxygen will be produced.

The effect of oxygen concentration in the range of 0–21% on photosynthesis was investigated in intact leaves of growing plants.

Photosynthetic [tex]CO_{2}[/tex] modification of higher plants is inhibited by oxygen in values ​​to less than 2%. The inhibition increases with the oxygen concentration and is about 30% in the case of 21% [tex]O_{2}[/tex] and 0.03% [tex]CO_{2}[/tex]. There is no doubt, therefore, that oxygen in the air normally exerts a strong inhibitory effect on the adaptation of plants to photosynthesis of [tex]CO_{2}[/tex] under natural conditions.

Oxygen production and the rate of photosynthesis are directly related. This means that as the rate of photosynthesis increases, more oxygen will be produced. This is the reason behind why  oxygen is created as a waste product from the light reactions in photosynthesis. Therefore, as photosynthesis occurs faster and faster, more oxygen will be created. Oxygen production is a simple way to measure the relative rate of photosynthesis in the lab.

For more such questions on Oxygen:

https://brainly.com/question/2272415

#SPJ4

approximately one week after conception, when differentiation of the cells begins, the zygote is now a group of cells that is more specifically called the

Answers

approximately one week after conception, when differentiation of the cells begins, the zygote is now a group of cells that is more specifically called the Blastocyst.

A typically developing embryo will have six to ten cells three days after fertilization. The fertilized egg is recognized as a blastocyst — a rapidly dividing ball of cells — by the fifth or sixth day. The embryo will be formed by the inner group of cells.

A blastocyst is a ball of cells that develops early in a pregnancy, approximately five to six days after a sperm fertilizes an egg. It implants in your uterine wall and develops into an embryo, then a fetus.

Blastocyst embryo transfer has a success rate of 67%, which is significantly higher than cleavage embryo (6-cell to 8-cell stage of the embryo) transfer.

For more information on Blastocyst , visit :

https://brainly.com/question/22090901

#SPJ4

Other Questions
when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation?