What are the answers here? Select all that apply.

What Are The Answers Here? Select All That Apply.

Answers

Answer 1

Answer:

the first, second, fourth, and fifth


Related Questions

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Patients wear protective gear when being X-rayed. What substance is being protected directly from mutation?

Answers

Answer:

Radiation has a potential of causing germ cell mutations that may be passed on to future generations.

Explanation:

i think so, hopefully this helps;(

Ionizing radiation damage cells and cause double-strand breaks that let more DNA in. These additional fragments of DNA find their way to the nucleus and cause cellular mutations. Protective gears are worn to prevent this.

What are X-rays ?

X-rays are a form of electromagnetic wave radiation. Using X-ray imaging, your body's interior can be visualized. The photos depict the various bodily parts in various shades of black and white. This is due to the fact that various tissues absorb radiation in different ways.

Ionizing radiation, a type of radiation that x-rays create, has the ability to destroy living tissue. This is a risk that gets worse the more exposures someone has over the course of their lifetime. However, exposure to radiation normally carries a low risk of acquiring cancer.

Therefore, protective gears are worn during x-rays to avoid mutations.

Learn more about X-rays, here:

https://brainly.com/question/2833441

#SPJ2

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

The music and pictures connected with a story can also show blas.
A
True
B.
False

Answers

Answer:

A

Explanation:

I took the question in a online quiz

it’s A i took a test about that question

ASAP Here is a nitrogen base sequence for a piece of one of the strands of a DNA molecule: ATTCGCGAT.

What would be the base sequence of the other complementary strand at this part of the DNA molecule?

Answers

Answer:

TAAGCGCTA

Explanation:

Which is NOT a function of lipids?

1.Absorption of Vitamins
2.Genetic Storage
3.Insulation/Cushioning
4.Energy

Answers

Lipids don't store genetic informations so the answer is 2

they absorb liposoluble vitamins they offer insulation/cushioning they store energy

28) 6CO2 + 6H20 + (energy) → C6H12O6 + 602

Where does the energy come from in the reactants side of the chemical equation?
Plz help I have 10 mins left

Answers

Answer:The energy change in a chemical reaction is due to the difference in the amounts of stored chemical energy between the products and the reactants. This stored chemical energy, or heat content, of the system is known as its enthalpy.

Explanation:

Answer: The energy in this reaction (photosynthesis) comes from light.

Sorry about cutting it close, hope this helps.

What reactant is needed in the light dependent reaction

Answers

Answer:

ATP and NADPH

Explanation:

they use it to reduce carbon dioxide and convert the energy into chemical bond energy in carbohydrates such as glucose

Explain why Hurricane Harvey traveled from the east (Africa) towards the west (Florida) when our weather in Wisconsin starts in the west and travels east?

PLEASE HELP!

Answers

Answer:

Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.

Explanation:

Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.

Mr. Szarka tries to sprint a marathon and comes up very short. Explain why foolhardy Mr. Szarka could not complete the marathon and what would happen to his energy systems once he rested and caught his breath. What processes would be restricted during this sprint attempt, and how would they be regulated?

Answers

Answer: It’s not in shape like it’s cut out

Explanation:

Answer:

he could not complete it cut he out of shape

Which of the following equations are balanced?

2Fe + Cu(NO 3) 2 → 2Cu + Fe(NO 3) 2
2K + 2H 2O → H 2 + 2KOH
Li + Cl 2 → LiCl
2H 2 + O 2 → 2H 2O
2S + 3O 2 → 2SO 3

Answers

Answer:

the second, fourth and fifth ones are balanced.

Someone smart PLS HELP!!!!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission the same way. Below are three ways it can split. Complete the nuclear equations so they balance.
fill in the blank line(s) pls pls pls pls pls pls help!!!!!!!

Answers

I’m 90% this is right

Sorry if I’m wrong

what is cell differentiation dependent on

many things
the number of chromatids
gene expression
the number of stages in the cell cycle

Answers

Answer:

many things..........

Think about the variety of biomes on Earth and differences in their weather patterns. Which list shows environments from highest
average temperature to be lowest average temperature?


A) swamp, mountain, desert

B) swamp, desert, mountain

C) desert, swamp, mountain

D) mountain, desert, mounatin

Answers

Answer:

C

Explanation:

hope this helps

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

What are biomes?

Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.

Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Learn more about biomes, here:

https://brainly.com/question/18601179

#SPJ6

25. Which of these does natural selection work on?
a. Only animals
b. All populations
c. Only microscopic organism
d. Individuals
e. Only small

Answers

The answer is B. Natural selection will find a way to affect one, then that one will affect many others.

Which of these can a wave carry from one place to another?
energy
matter
particles
water

Answers

Answer:

energy

Explanation:

hope its is correct!!

Summarize the possible applications of gene knockout GMOs.

Answers

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

. A protease is added to a suspension of egg protein in a test-tube and kept at 37°C. After 8 minutes, the protein changes from cloudy to transparent. Which product, or products, will now be present in the test-tube

Answers

Answer:

amino acids

Explanation:

A protease is an enzyme capable of catalyzing the breakdown of proteins into polypeptide fragments and single amino acids, which are the building block of proteins. Proteases act by breaking peptide bonds by a process called hydrolysis, a reaction where water molecules break down peptide bonds (hydro means water and lysis means split). Proteases can be classified depending on the catalytic residue into cysteine, serine, threonine, aspartic, glutamic and metalloproteases.

The product that will be present in the test tube will be amino acids.

Protease is an enzyme that acts on protein by converting it into different

types of amino acids.

Amino acids are referred to as the building block of life and are important

nutrients in growth and replacement of worn-out tissues. The protease acts

on the protein by breaking the peptide bonds under the required

temperature.

An inadequate temperature may result in the denaturing of the enzyme

which was why the test was done at 37°C. This is the body temperature of

humans which led to the formation of amino acids which is absorbed by cells

of the body.

Read more on https://brainly.com/question/20299415

A wetland that contains a mixture of fresh water and salt water is called
an estuary
a stream
a river.
a pond

Answers

Answer:

an estuary

Explanation:

A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.

What is an estuary?

An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.

Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.

Therefore, the correct option is A.

Learn more about Estuary here:

https://brainly.com/question/17564221

#SPJ6

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

what type of species is a key element in keeping the ecosystem in balance

Answers

Answer:

predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.

Explanation:

Answer:

keystone species

Explanation:

What cellular function is negatively impacted by an increase in cell size?

Answers

Answer:  c

Explanation:

Multiply (2x + 5)(3x - 4).

Answers

The answer is : 6x^2 + 7x -20

Answer:

6 [tex]x^{2}[/tex]  +  7 x  −  20

If an organism has 30 chromosomes in its body cells, how many chromosomes would it have in its sex cells (gametes)?

Answers

Answer:

15

Explanation:

Gametes have half the amount of dipliod somatic ells

Which product of respiration is considered waste material and leaves the alveoli?
O oxygen
O water
O carbon dioxide
O carbon monoxide

Answers

Answer:

In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide

I hope you have a great day!

The waste product of respiration is

C. Carbon dioxide

The oxygen consumed via stomata is used up by cells.

Respiration in leaves:

Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.

Thus, option C is correct.

Find more information about Respiration here:

brainly.com/question/18169685

HELP ME WITH THIS PLEASE!!!!!!!

Answers

Answer:

c

Explanation:

Answer:

Primary consumer.

Explanation:

Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.

Do you get it now?

PLS HELP ASAP
Section 4: Answer the following analysis questions about your proposed solutions. 1. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. 2 Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. 3. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. 4. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?​

Answers

Answer:

Section 4: Answer the following analysis questions about your proposed solutions.  

Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. The Koalas won’t be extinct.

Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. They will impact because they will be helping.

Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. I would pick the food because they need to have protein to live longer.

How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs? If people want to see them at the zoo, then they should take care of them.

There u go!!!! Hope this helps.

And if someone else answers, can I have the brainliest?

Have an amazing day :D

Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.

What is protein?

It makes up the enzymes that power many chemical reactions and the hemoglobin that carries oxygen in your blood. At least 10,000 different proteins make you what you are and keep you that way.

Protein is made from twenty-plus basic building blocks called amino acids.

Because we don’t store amino acids, our bodies make them in two different ways: either from scratch, or by modifying others. Nine amino acids—histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine—known as the essential amino acids, must come from food.

Therefore, Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.

To learn more about protein, refer to the link:

https://brainly.com/question/17095120

#SPJ5

How does geotheHow does geothermal energy differ from solar energy?

Geothermal energy is cooler and denser than solar energy.
Geothermal energy comes from the internal heat of Earth.
Geothermal energy is transmitted through the atmosphere.
Geothermal energy results from radiation of electromagnetic waves.rmal energy differ from solar energy?

Answers

Answer: B || Geothermal energy comes from the internal heat of Earth.

Explanation:

hope it helped xx :))

Explain how specific proteins are formed from a strand of mRNA.

Answers

Answer:

During translation, ribosomes move along an mRNA strand, and with the help of proteins called initiation factors, elongation factors, and release factors, they assemble the sequence of amino acids indicated by the mRNA, thereby forming a protein.

Explanation:

Answer:

Explanation:

Los ARN mensajeros, también conocidos como ARNm, son uno de los tipos de ARN que se encuentran en la célula. Éste en particular, como la mayoría de los ARN, se sintetiza en el núcleo y luego se exporta al citoplasma, donde la maquinaria de traducción, la maquinaria que realmente fabrica las proteínas, se une a las moléculas de ARNm y lee en ellas el código para producir una proteína específica. Así que en general, un gen, el ADN de un gen, puede ser transcrito en una molécula de ARNm que puede acabar dando lugar a una proteína específica.

Find the EXACT area of the shaded. The square has a side length of 24 meters.

Answers

Answer:

Explanation:

If the entire square is shaded and that 24m being the measurement of just one side just multiply 24 by 24 which is 576[tex]m^{2}[/tex]

If you are saying that 24 is the length of all of the sides combined just divide 24 by 4 to get one side and square it. 6 times 6 and you get 36[tex]m^{2}[/tex]

Other Questions
Last week Len spent $18 to bowl 4 games. This week he spent $27 to bowl 6 games. Len owns his bowling ball and shoes, so he only has to pay for each game that he bowls. If each of these bowling games costs the same amount of money, what is the constant of proportionality between the money spent and the number of games played? What dose this section reveal about the character hucks perspective on education A 500 kg car is moving at 30 m/s. The driver sees a barrier ahead. If the car takes 100 m to come to rest, what is the magnitude of the force necessary to stop the car?How do you solve this question? Which word is the most different from the others? a. burden b. advantage c. difficulty d. hardship Which digit is in the thousandths place?52.398 Did Benjamin Franklin believe that fighting a war and causing death on behalf of ones religion a moral cause?Explain!!! Ill give BRAINLIEST! A particle with mass of 200 kg is acted on by a net force of 4.5N. The acceleration of the particle is most nearly how do i do this math problem? Help ASAP Please. Working on this now. Look at picture for question and answer A, B, C What is a climate hazard ( put in your own words ) - do not copy of internet please I will give brainslt for correct answer. Which power is not given to Congress? Use the system of equations to answer the questions.5x+4y=3y=2x+6The value of y from the second equation is substituted back into the first equation. What is the resulting equation?What is the value of x?What is the value of y? Write the factor that corresponds to the zero: x=-7Write the factor that corresponds to the zero: x=2Write the zero that corresponds to the factor (10x-9) Conjugate the Regular Verbs:Nosotros(toser) de vez en cuando. What is the Slope of the slide? What must be subtracted from the product of 25 and 23 to equal 275 Which process begins with the replication of DNA in the nucleus of a cell?A. cell divisionB. energy captureC. protein synthesisD.cellular respiration Lakshmi is a goddess representing A: the fall harvest B: good fortune B: light A production process produces 5% defective parts. A sample of five parts from the production process is selected. What is the probability that the sample contains exactly two defective parts Please help fast too easy questions for double the points Ill give brainless also and 10 point!