Use the graph and the table above to complete the table by estimating the amount of energy transferred near location B.

A.
1600 kilojoules

B.
300 kilojoules

C.
800 kilojoules

D.
400 kilojoules

E.
3200 kilojoules

Use The Graph And The Table Above To Complete The Table By Estimating The Amount Of Energy Transferred
Use The Graph And The Table Above To Complete The Table By Estimating The Amount Of Energy Transferred

Answers

Answer 1
The answr is A
Step explain
Answer 2
The answer is A 1600 kilojoules

Related Questions

Which statement best describes the overall chang
O One cell becomes two cells that have identical
OOne cell becomes two cells that have different
O Two cells become tWo cells that have identical
O Two cells become two cells that have different

Answers

Answer:number one

Explanation:

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

from his monohybrid crosses, Mendel developed his first law

Answers

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

explain the process of digestion abd absorption of carbohydrates.​

Answers

Answer:

Carbohydrate digestion breaks down disaccharides (sugar) and complex carbohydrates into a simpler sugar so it can be absorbed. But not all are completely absorbed in the small intestines.

Explanation:

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

What is relationship between genes dna and proteins

Answers

Answer:

genes are created by proteins. dna is created by genes

Explanation:

Most genes contain the information require to make proteins. The journey from gene to protein is one that is complex and controlled within each cell and it consists of two major steps – transcription and translation. Together, these two steps are known as gene expression.

Bam hi cuts between what bases

Answers

bam hi cuts?
can you clarify what that is so i can help you?

4.
What is the importance of biodiversity to humans and to ecosystems?

Answers

Answer:

Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.

Explanation:

looked it up

18. Viruses are considered
because they can not perform the characteristics of life without a
19. Viruses are made of two basic compounds,
and a
made of protein.
20. A virus infects a cell by injecting
into a cell.

Answers

Answer:

6. antibodies and DNA for the question no.6

Please pleaseeee helppppp I’ll mark the brainliest!!!

Answers

Answer:

the first option is correct

Explanation:

Answer:

the lest one

Explanation: darwen belived

What are the products of photosynthesis?

Answers

Answer:

glucose and oxygen

Explanation:

just aced a unit test on this subject

AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.

Answers

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.

1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.

In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.

2. In the given set, the possible amino acid sequences can be given as:

Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.

In the given sequence:

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.

To know more about codons, refer to the following link:

https://brainly.com/question/19153211

Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.

Answers

Process of elimination is helpful for this question.

You can already remove B, and D, because if you were to be taking these classes, you would know that blood obviously has red blood cells in it, and it is rich in oxygen.

This leads into the answer:
of A, which is the correct answer of “It is oxygen rich.”

C is a no contest answer because blood in the arteries actually moved away from the heart, not towards it.

Hope this helps :)))

It is oxygen rich

What do you mean by arteries?

The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.

What is oxygenated blood?

Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.

To learn more about arteries here

https://brainly.com/question/3306673

#SPJ2

Fossil fuels, such as oil and natural gas, are primarily formed from the remains of what?
phytoplankton
mammals
bacteria
dinosaurs​

Answers

Answer:

phytoplankton

Explanation:

Answer:

Its phytoplankten.

Explanation:

I hope I spelled it right

How does sexual reproduction increase the variance of traits in a population?

Answers

Sexual reproduction provides genetic diversity because the sperm and egg that are produced contain different combinations of genes than the parent organisms. ... Sexual reproduction involves meiosis, which is the process of a cell doubling its DNA, shuffling its genes, and then dividing the shuffled DNA among four cells.

why would an athlete need to be concerned about a twitch or sustained contraction​

Answers

Answer:

why an athlete would need to be concerned about twitches or contractions is because, whenever they perform, and such thing happens, it will most likely distract the athlete, and cause the athlete doing his/her performance to not be as good, and may lead to failure, for example, when someone is running very fast for a sprinting race, and he has a contraction in his leg it will cause him to react by showing signs of pain by slowing down or even tripping and falling, causing him to lose the race.

Hope this Helped!

what he said gll :))

Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment. What relationship is shown here between the mistletoe and the tree?

A.Competition
B.Parasitism
C.Mutualism
D.Commensalism

Answers

The answer is B.Parasitism

Mistletoe extracts water and nutrients from the spruce, to the spruce tree's detriment. The relationship that is shown here between the mistletoe and the tree is Parasitism. Hence, the correct option is B.

What is Parasitism?

Parasitism refers to a type of symbiotic relationship in which one organism benefits at the expense of the other organism, which is called host. The parasite lives on or inside the host and derive nutrients as well as shelter from the host, thereby providing no benefit to the host in return.

Examples of parasites includes tapeworms, roundworms, lice, fleas, and some species of bacteria and viruses.

Parasitism is a common for of symbiosis in nature and play an important role in shaping the relationships between species and maintaining balance in ecosystem. Hence, the correct option is B.

For more details regarding parasitism, visit:

https://brainly.com/question/29759870

#SPJ6

Which statement best describes Mendel's principle of segregation?​

Answers

Answer:

Inherited traits are controlled by two factors that separate during reproduction.

Explanation:

what in your dna are responsible for determining the traits that are expressed in an organism
1. mutagens
2. replication
3. cell
4. gametes
5. genes
6. meiosis

Answers

Answer:

Genes

Explanation:

Gene. A segment of a DNA molecule (a sequence of bases) that codes for a particular protein and determines the traits (phenotype) of the individual. A gene is the basic unit of heredity in a living organism.

Which relationship is an example of commensalim?

Answers

One of the most poplar examples of commensalism is the relationship between cattle egrets and livestock. The cattle egret is a common species of heron that is found in most regions of the world, and is mostly seen moving along with herds of cattle. This bird moves about in pastures, and follows livestock such as cattle and horses.

What is the net ATP gain at this stage of cellular respiration?
2
4
32
36

Answers

Answer:

The answer is A.) 2, Edge 2022

Explanation:

The net ATP gain at this stage of cellular respiration is 36. Therefore, option "D" is correct.

What is cellular respiration?

A series of chemical reactions known as cellular respiration breaks down glucose into ATP, which can be used as energy to power numerous body processes. Cellular respiration has three main stages: the citric acid cycle, glycolysis, and oxidative phosphorylation.

In eukaryotes, the 4 phases of cell breath incorporate glycolysis, progress response (pyruvate oxidation), the Krebs cycle (otherwise called the citrus extract cycle), and oxidative phosphorylation through the electron transport chain.

Therefore, cellular respiration is the main process that generates ATP and gives energy to the body to work.

Learn more about cellular respiration, here:

https://brainly.com/question/29760658

#SPJ7

an atom that has gained or lost one or more electrons

Answers

This is called an ion. :)

Please help me on this question

Answers

the first one goes with pollutes groundwater , the second one goes with harms aquatic creatures & the last one goes with destroys animals habitats .

What phase is mitosis in

Answers

Answer:

prophase, prometaphase, metaphase, anaphase, and telophase.

Explanation:

How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years?
A.
The Grand Tetons will stay exactly the same as they are today.
B.
The Grand Tetons will become steeper and more rugged.
C.
The Grand Tetons will become less steep and more rounded.
D.
The Grand Tetons will become much taller than they are today.

Answers

Answer:

the correct answer to the question in c

Answer: C)The Grand Tetons will become less steep and more rounded.

Explanation:

How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years? C)The Grand Tetons will become less steep and more rounded.

Select all that apply.


The first known pandemic in A.D. 542, struck which parts of the world?



Australia

Middle East

North America

South America

Asia

North Africa

Europe
PLEASE ANSWER CORRECTLY

Answers

I think it's Asia.....

Sean and Catherine have 4 kids. Each kid has a different blood type. The public immediately assumes that Sean couldn't be the father. is this necessarily true? Use Punnett squares to show your work for if it is possible for them to have these 4 kids.
PLEASEEEE HELPPP!!!!!

Answers

It’s not necessarily true!

Here’s an example I drew out!

As Sean and Catherine have four kids and each is different blood type. The public assumes Sean as father and Catherine as mother which is not  necessary true.

The Puneet square is a helpful method to predict the variations and probability of cross-breeding. There could be possibly four changes such as blood group of Sean is A and Catherine is B then. Dominant blood group be found AA, AB, A an B blood group.

Learn more about Catherine have 4 kids.  

brainly.com/question/20757353.

Using the data provided, how can we describe the difference between amplitude of an average wave in location B?



Compared to location A, an average wave in location B

A.
has more distance between it and the next wave.

B.
has less energy.

C.
is higher from the bottom to the top of the wave.

D.
has less distance between it and the next wave.

Answers

Answer:

has less distance between it and the next wave

The answer is d has less distance between it and next wave

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

A geneticist crossed pure breeding black mice with pure breeding brown mice. All the mice in the F1 generation had black coats. When these mice were crossed, they yielded 961 black coated mice and 317 brown coated mice.

Fill in the new combinations of alleles in the F2 generation.

Answers

Answer:

The correct answer is - the brown allele is not independent from the black allele and disappears in the F1 generation.

Explanation:

IN this question it is given that there is a cross between pure black and pure brown breed and the F1 generation has all-black coat offspring and their self cross produced 961 black and 317 brown.

The black coat offspring is three times than the brown coat offspring in F2 generation which means they have 3:1 ratio that comes in the self cross of heterozygous only there for the F1 generation black coat offspring have the heterozygous genotype for the trait,

Thus, the brown allele is not independent of the black allele and disappears in the F1 generation.

Other Questions
How did geography influence the movement of people and goods across the continent in the 1800s? Why was Fort Ticonderoga important to the colonists? help plz and dont answer if u dont know plz Write an algebraic expression for the phrase 6 times Z PLEASE HELP FAST FAST FAST Use the interactive number line to graph the inequality -1 x. I'LL GIVE BRAINLIEST TO WHOEVER ANSWERS THE QUESTION CORRECTLY!!!!Is the following statement true or false?The triangle proportionality theorem only applies to right triangles.A.) FalseB.) True Why didnt the Allies from WWI stop Hitler? How many passes will it take to find the four in the list 4,5,6,7,8,9,10 There are 20 consecutive even numbers. How much bigger is the sum of the larger 10 ones than the sum of the smaller ones? Pleaseeeeeeee helppppppp thankssssss I need help can you guys answer it the question is which rate describes a unit rate of 8:1??? options:A: 12 feet for 3 dogs B:40 miles for 5 hours C: 70 for 5 umbrellas D: 45 sit ups in 9 seconds 512of the pupils in Year 9 say their favourite colour is red.There are 180 pupils in Year 9.How many students said red is their favourite colour? and fast plzzwill .ark the brainliest which number will complete the given series 50,48,44,42,38,36? Which class doubled in size during the years between 1900 and 1925?A. wealthy classB. working classC. middle classD. farming class WHY IS DRAKE SO FRGGIN COOOLIO ??? LIKE I LOVE HIM HAHAHAH ANYWAYS I NEED HELP ANS FRIEDNDSS HAHAHAHA Why are they called epic poems Does anyone know pls help... What happens to the hair of a hog that is infested with lice? discuss a social issue that you feel deeply about. describe how you would contribute to the solution