Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
According to the graph, which region's population is expected to get smaller
between 2010 and 2050?
Answer:
Europe
Explanation:
it's the only line that slopes downward between 2010 and 2050
what was the major theme in the story Lizzie Bright and the Buckminster boy?
Answer:
Love as expressed in healthy, giving human relationships is the overriding theme of the story. It is the essence of religion, the ultimate truth, the logical expression of freedom, and the cure for racism and intolerance
Explanation:
How are meiosis and mitosis different?
'FREE BRAINLIEST INCLUDED'
Answer:
a is the write answer
Explanation:
During strenuous exercise, lactic acid fermentation begins because the muscle cells are not getting enough
water
glucose
oxygen
ATP
Answer:
oxygen
Explanation:
Without oxygen aerobic respiration cannot occur. Therefore ATP is produces by anaerobic reparation which is from glycolysis only. Lactate/ lactic acid is formed when glycolysis is the only production of ATP.
62.5 milligrams into grams
Explanation:
62.5 = 0.0625 g
your answer is like thisif you have been victimized by fake news how can you respend?
pasagot plss!!!
Question
If you have been victimized by fake news how can you respond?
Answer
If i have been victimized by fake news i already do.. is to stop the spreading of these fake news This goes beyond just not sharing news stories until i have determined they are genuine, but also not sharing fake news. When you share a piece of fake news you are raising its publicity and advertisement revenues.
Hope my answer will help you ^^
#LearnWithBrainly
in your own words, what is the definition for Exocytosis?
Answer:
the release of cellular substances.
Explanation:
hope this helps
Because the imaginary axis of the earth is inclined to the sun at the equator, the northern and southern hemispheres shine in different ways. When it is summer in the northern hemisphere of our planet, then it is winter in the southern hemisphere
Answer:
Yes.
Explanation:
Yes, when it is summer in the northern hemisphere of earth, then it is winter in the southern hemisphere. This change of season occur due to tilting of earth. The season of northern hemisphere and southern hemisphere are different and opposite to each other because both are present at opposite location on the earth surface. The tilting region experience winter season whereas the other regions experience summer due to direct sunlight.
Cuanto más fría es la temperatura en un lago, más oxígeno retiene el agua. Daniel se da cuenta de que pesca más peces en un lago que está a menos de 55 grados. Quiere realizar un estudio para capturar la mayor cantidad de peces posible este año. Necesita un poco de ayuda para escribir una pregunta comprobable y una hipótesis. Por favor ayudarlo.
Answer:
- Pregunta ¿la temperatura incide en la cantidad de oxígeno disuelto en el agua del lago?
- Hipótesis: temperaturas más frías están directamente asociadas con un incremento en la cantidad de oxígeno disuelto en el agua del lago
Explanation:
Para poder aplicar el método científico, lo primero que debemos hacer es formular una pregunta sobre algún fenómeno observado en el mundo natural. A continuación debemos formular una explicación posible o 'hipótesis' que permita responder la pregunta que formulamos anteriormente. A partir de la hipótesis podemos diseñar experimentos y/o observaciones empíricas que permitan probar la veracidad de nuestra hipótesis de trabajo. En este caso, por ejemplo, el experimento podría consistir en la medición y posterior comparación del nivel de oxígeno disuelto en el agua del lago durante la temporada de altas temperaturas versus la temporada de bajas temperaturas. Finalmente, los resultados observacionales/experimentales nos permitirán comprobar o rechazar la hipótesis de trabajo (en este caso, nuestra hipótesis es que el nivel de oxígeno disuelto es mayor a bajas temperaturas), obteniendo de este modo una conclusión a partir de nuestro trabajo.
Pea plants can have yellow seeds or green seeds. Which conclusion about the meaning of Y is correct if the allele combination Yy is for yellow seeds?
Answer:
yellow and dominant
Explanation:
In genetics, complete dominance occurs when a gene variant referred to as 'dominant allele' completely masks the expression of another allele referred to as 'recessive allele' in heterozygous individuals (i.e., individuals carrying one copy of the dominant allele and one copy of the recessive allele) at a specific locus. In this case, the yellow (Y) allele is dominant for the trait of 'color seed' with regard to the recessive (y) allele, which is responsible for the phenotype of green seeds, and therefore heterozygous individuals (Yy) will have yellow seeds.
2
2.When chemical bond are formed
energy is released.
True
False
Answer:
true
have a nice day and good dayJust by looking at the guinea pig, you would be able to tell if its genotype were HH or Hh.
A. True
B. False
Answer:
it depends on where your going to be looking if you look at the genitals then A true but, if your looking at just the body and head B
Answer:
B. False
Explanation:
HH and Hh have the same phenotype, so you could not determine the genotype of the guinea pig just by looking at it.
During which phase of the cell cycle are chromo-
somes copied?
Answer:
S phase
Explanation:
S phase is the second phase of interphase (longest phase where cell grows and replicates it's DNA and does it function. It is broken up into smaller sub phases). S phase is the synthesis phase. During this phase chromosomes are replicated ( The DNA is copied).
Why is the percentage of food eaten a good
number to use? Explain.
I
Intro
Answer:
The percentage of food gives an idea about the food availability for the species of organisms. If the food percentage is high the species is observed to be more successful; on the other hand if the percentage is low the species is found to shrink in numbers.
hope it helps
3) In order for an ecosystem to thrive, it needs to exist in a form of harmony and balance between its biotic and abiotic factors. Describe how small changes to both biotic and abiotic components can have major effects on an ecosystem.
Answer:
Changing temperature causes extinction or removal of organism from that place.
Explanation:
Small changes to both biotic and abiotic components can have major effects on an ecosystem because these are the factors on which the ecosystem depends. For example, if the temperature of the ecosystem increases from its limit, it makes the environment unfavourable for the organism so due to this change, the organism migrated to other location otherwise they will die due to unfavourable environment.
Does the volume increase with trial number, decrease with trial number, or stay about the same? Explain why you think the results are the way there are. There are many possible reasons for the data trend you see. Give some that you think are reasonable.
Hi. You have not informed the experiment that this question refers to and this makes it difficult for your question to be answered. However, I researched your question on the internet and was able to find a question like yours that featured an experiment that assesses the volume of balloons that have been inflated by people's breath.
With the reading of the experiment, we can see that the volume of the balloons remains the same through the number of tests. This is because our lungs tend to express the same amount of air when we blow, just as we tend to breathe the same amount of air in normal situations. This probably happened because all the balloons were filled with air, while the individuals were in the same physical and mental state, that is, they were relaxed and still, which did not change the amount of air they breathed and expelled. This volume of air would be different if the participants in the experiment were exerting some physical effort or were stressed and anxious.
You have learned that scientists have found physical evidence of the Flood. In this project you will think about Noah and his construction of the ark.
Pretend that you are a newspaper reporter, and you are able to interview Noah. Then write a newspaper article about your interview.
Answer these questions.
What kinds of questions would you ask him?
Write a news article on your interview with Noah. (100 words or more is fine)
Need help asap just answer write the article the first 1 i already answered just copy pasted the questions
Answer:
We got a chance to speak to Noah the Ark builder. Many people of the town have been wondering what Noah has been building lately. We asked him what was his objective and he said "A great flood like no other will come, water from the sea will fall from the air. Whoever is in the ark shall be safe. Two of each type of animal on earth shall come to my ark for shelter. The storm will be so great it will knock out all who does not inhabit the ark."It is hard to understand what he means by these statements but who knows maybe his boat will take him somewhere. The people of the town have been calling him insane, since no one would need a boat that big.
(I'm guessing that you mean the interview was before the flood since everyone died after.)
Mutations cause _______ to the body shape, size, color, or function of the organism that inherits the mutation.
A. a brand new species to pop up
B. clones
C. variations
Answer:
C. Variations
Explanation:
Mutations are genetic disorders, they do not cause clones. Various breeding and deformities over centuries can cause new species, but they are not the same as genetic mutations.
Answer:
C. variations
Explanation:
Mutations cause variations to the body shape, size, color, or function of the organism that inherits the mutation.
 The graph below shows how the level of carbon dioxide in the atmosphere has changed over the last 150,000 years Which environmental factor has been most recently affected by these changes in carbon dioxide level?
1. light intensity
2. size of consumers
3. types of decomposers
4.atmospheric temperature
[tex]what \: is \: endoplasmic \: reticulum \: {?} \: [/tex]
Answer:
They are elaborate network of channels running through the cytoplasm. There are two types of endoplasmic reticulum. They are; Rough and smooth endoplasmic reticulum. Rough endoplasmic reticulum are rough because of the presence of ribosomes. Smooth endoplasmic reticulum are smooth because they dont have ribosomes.
meaning:an extensive intracellular membrane system whose functions include synthesis and transport of lipids and, in regions where ribosomes are attached, of proteins
Hello, I need to know what is at least one reason that their is Global Warming. Whats causing it?
Answer:
Increased heat, drought and insect outbreaks, all linked to climate change, have increased wildfires.
Explanation:
Hope this helps!
What does "synthesis" mean?
A. to read DNA
B. to tear apart
C. to make something
Answer:
I believe it is C to make something
A circular ring of DNA that typically exists in bacteria and that codes for certain traits is known as a/n
Answer is Plasmid.
A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's chromosomal DNA. Plasmids naturally exist in bacterial cells, and they also occur in some eukaryotes. Often, the genes carried in plasmids provide bacteria with genetic advantages, such as antibiotic resistance.
What makes Protists different from the Bacteria kingdoms?
A. They are easier to find.
B. Their cells have a nucleus.
C. They are bigger.
Answer:
B. Their cells have a nucleus.
Explanation:
The primary difference between them is their cellular organization. Bacteria are single-celled microbes and are prokaryotes, which means they're single-celled organisms lacking specialized organelles. ... In contrast, protists are mostly single-celled eukaryotic organisms that are not plants, fungi, or animals.
Answer:
B. Their cells have a nucleus.
Explanation:
Protists are different from the Bacteria kingdom because, their cells have a nucleus.
What do sea squirts eat?
Answer:
sea squirts eat plankton
Explanation:
if water were a nonpolar molecule, how would its properties be different
Explanation:
If water were a nonpolar molecule how would its properties be different A. Water would be able to climb inside plants. ... Water would stick together much more strongly.
somebody help pls I’m pretty sure it’s negative but I don’t know if it’s maintain or disrupt
Answer:
negative and maintain is the answer
In biology, evolution explains exactly how life began on Earth
A. True
B. False
Answer:
I would say False. But not 100% sure.
Explanation:
Hope this helps you in some way.
Which statement best describes energy entering the living world?
a) solar energy to chemical energy
b) chemical energy to solar energy
c) solar energy to heat energy
d) heat energy to solar energy
Answer:
a. solar energy to chemical energy
Answer:
A .Solar energy to chemical energy
Explanation:
How can a mutation get into a population?
Answer:
Some mutations do not result in changes in the amino acid sequence of the encoded protein and can be described as silent mutations. Other mutations result in abnormal protein products. Mutations can introduce new alleles into a population of organisms and increase the population's genetic variation.
Explanation:
Answer:
Some mutations do not result in changes in the amino acid sequence of the encoded protein and can be described as silent mutations. Other mutations result in abnormal protein products. Mutations can introduce new alleles into a population of organisms and increase the population's genetic variation.
Explanation: