The T-Shirt Factory purchased 12 futures contracts on cotton at a quoted price of 55.50 as a hedge against its inventory needs. At the time it actually needed the cotton, the spot price was 56.10. Cotton futures are based on 50,000 pounds and quoted in cents per pound. How much did the Shirt Factory save by hedging cotton?
A. $1,280
B. $560
C. $2,400
D. $3,600

Answers

Answer 1

Answer:

D

Explanation: ……….


Related Questions

Help pls


Bob is a funeral director. What might be one task that Bob performs as part of his job?


Question 9 options:


arranging for daily care for an elderly person



running a local food bank that delivers meals



placing an obituary in the local newspaper



organizing a community roadside clean up

Answers

Answer:

c

Explanation:

placing obituary in the local newspaper

Answer:

In my opinion i think that the answer would be...

A.arranging for daily care for an elderly person

Explanation: Trust me! Hope this help you! Let me know if its correct good luck! :)

Overseas Shipping Corporation and Port Storage Company transfer their assets to Quality Operations, Inc., which manages the assets and distributes the profits to the beneficiaries. This form of business organization is

Answers

Based on the information given, it can be illustrated that the form of business organization that's depicted is a business trust.

A business trust is also known as common law trusts. They are legal instruments that provide a trustee the authority and power to be able to manage the interest of a beneficiary in a business.

Since Overseas Shipping Corporation and Port Storage Company transfer their assets to Quality Operations, Inc., which manages the assets and distributes the profits to the beneficiaries. This is known as a business trust.

Learn more about businesses on:

https://brainly.com/question/24388522

Management of Wee Ones (WO), an operator of day-care facilities, wants the company's profit to be subdivided by center. The firm's accountant has provided the following data:
Center Budgeted Revenue Actual Revenue Budgeted Direct Costs Actual Direct Costs Downtown $ 342,000 $ 363,300 $ 310,000 $ 347,600 Irvine 598,500 622,800 573,500 521,400 H. Beach 769,500 743,900 666,500 711,000 Totals $ 1,710,000 $ 1,730,000 $ 1,550,000 $ 1,580,000
WO's advertising, which is handled by the home office, is not reflected in the preceding figures and amounted to $74,000. Assume that management used the allocation base that is most influenced by advertising effort and consistent with sound managerial accounting practices. How much advertising would be allocated to the Irvine center?

Answers

Imma need more than 10 pionts1299 wo2929191

Suppose the cross-price elasticity of travelling by bus and travelling by train is 0.7. If the price of traveling by bus increases by 40%, how much would the quantity of traveling by train change

Answers

The quantity of traveling by train would change by 28%.

Cross-price elasticity measures how the quantity demanded of a good is affected by changes in the price of another good.

Cross price elasticity = percentage change in the quantity demanded of good A / percentage change in the price of good B.

0.7 = percentage change in the quantity of traveling by train / 40%

Percentage change in the quantity of traveling by train = 40 x 0.7 = 28%

To learn more about cross price elasticity, please check: https://brainly.com/question/26035503

7 thousand shares of treasury stock of Marker, Inc., previously acquired at $14 per share, are sold at $20 per share. The entry to record this transaction will include a

Answers

Based on the information given the entry to record this transaction will include a credit to  additional paid-in capital for $42,000.

Marker, Inc. Journal entry

Debit Cash $140,000

(7,000 shares×$20 per share)

Credit Treasury stock $98,000

(7,000 shares×$14 per share)

Credit Additional paid-in capital - treasury stock $42,000

[($20-$14)×7,000 shares]

(To record treasury stock)

Inconclusion the entry to record this transaction will include a credit to  additional paid-in capital for $42,000.

Learn more about treasury stock here:https://brainly.com/question/8054097

Help help help help help

Answers

D is the right answer

One goal of the Occupy Movement was to encourage the practice of bank bailouts.
Group of answer choices

True

False

Answers

True I think I’m not sure :/

Help help buddies pelsss I’ll give points I need straightforward answer ASAP

Answers

Answer:

1

Explanation:

1 divided by 1 is 1

100% in number form is 1

The answer is::::

C. 1

explain the appearance of earthworm in brief​

Answers

Explanation:

An earthworm is a terrestrial invertebrate that belongs to the phylum Annelida. They exhibit a tube-within-a-tube body plan, are externally segmented with corresponding internal segmentation, and usually have setae on all segments. They occur worldwide where soil, water, and temperature allow

1) consider any leader you are aware of from study or the media. Do they confirm to the myths set out in the text or do they transcend that? 2) What is your personal leadership style? What benefits and problems does it generate for you and orgamization? 3) How important is integrity to a leader in your opinion? Give examples to support your views?

Answers

Based on the information given, a leader that I'm aware of is Mahatma Gandhi. He was an ambassador of non-violence.

A leadership style simply means providing direction, implementing plans and also motivating people. My personal leadership style is pacesetting and motivating others.

Integrity makes one secure and confident.  Someone who has integrity is honest about his or her morals and values. Therefore, such a person can be trusted.

Learn more about leadership on:

https://brainly.com/question/1232764

Ann got a 30 year Fully Amortizing FRM for $1,000,000 at an annual interest rate of 7% compounded monthly, with monthly payments. After 5 years of payments, Ann can refinance the balance into a 25 year Fully Amortizing FRM at an annual interest rate of 6% compounded monthly, with monthly payments. Refinancing will cost Ann 1 point and $1, 500 in closing costs.If Ann refinances into this loan and makes payments for 25 years, what will be her annualized IRR from refinancing?

Answers

Based on the information given what will be her annualized IRR from refinancing is 64.799%.

First step is to calculate the PMT

PMT=PV× rate/[1-(1+rate)^time

PMT=$1,000,000×0.07/12÷[1-(1+0.07/12)^30×12

PMT=$1,000,000×0.07/12÷[1-(1+0.07/12)^360

PMT=$1,000,000×0.005833333÷[1-(1+0.005833333)^360

PMT=$5,833.333÷[1-(1.005833333)^360

PMT=$6,653.02

Second step is to calculate the present value (PV) after 5 years

PV=PMT×[1-(1+rate)^time/rate

PV=$6,653.02×1-(1+0.07/12)^25×12÷0.07/12

PV=$6,653.02×1-(1+0.07/12)^300÷0.07/12

PV=$6,653.02×1-(1+0.005833333)^300÷0.005833333

PV=$6,653.02×1-(1.005833333)^300÷0.005833333

PV=$941,315.20

Third step is to compute PMT for refinancing  when rate is 6%

PMT=PV× rate/[1-(+rate)^time

PMT=$941,315.20×0.06/12÷[1-(1+0.06/12)^360

PMT=$941,315.20×0.005÷[1-(1+0.005)^360

PMT=$4,706.576÷[1-(1.005)^360

PMT=$6,063.72

Third step is to calculate the monthly savings

Monthly savings=$6,653.02-$6,063.72

Monthly savings=$589.30

Fourth step is to calculate the Cost of refinancing

Cost of refinancing=1%×$941,315.20+$1,500

Cost of refinancing=$9,413.152+$1,500

Cost of refinancing=$10,913.152

Fifth step is to calculate the IRR

PMT savings=Cost of refinancing ×IRR÷[1-(1+IRR)^time

$589.30=$10,913.152×IRR÷[1(1+IRR)^300

Monthly IRR=5.3999%

Annualized IRR=5.3999%×12 months

Annualized IRR=64.799%

Inconclusion what will be her annualized IRR from refinancing is 64.799%.

Learn more about annualized IRR here:https://brainly.com/question/24129329

You sell friendship bracelets. You have an agreement with your best friend, Georgina, who is a great artist
in photography, that she will photograph all her subjects wearing your friendship bracelets. You have
agreed that you will get 25 percent of the proceeds from the sale of photographs and she will get 25
percent of the sale proceeds from your bracelets. It turns out that Georgina had a photo-lab partner who
actually did all the film and photo development while she just took the pictures, and who wanted part of her
proceeds. Because of this arrangement, you are considered to be a partner with him.
False
Theo

Answers

Answer
False

Explanation
You are still giving her the 25% not him

Hep help please straightforward answer please thanks thanks

Answers

Answer:

C

Explanation:

Sapphire Aerospace operates 52 weeks per year, and its cost of goods sold last year was $6,500,000. The firm carries eight items in inventory: four raw materials, two work-in-process items, and two finished goods. Table 12.3 shows last year’s average inventory levels for these items, along with their unit values. a. What is the average aggregate inventory value? b. How many weeks of supply does the firm have? c. What was the inventory turnover last year?

Answers

a. The average aggregate inventory value is $336,000.

b. The number of weeks of supply that the firm has is 3 weeks, approximately (2.69 ($336,000/$6,500,000 x 52).

c. The inventory turnover of Sapphire Aerospace for last year was 19.3x.

Question Completion:

Category        Part Number        Average           Value        Total      Category

                                              Inventory Units    per Unit      Value        Totals

Raw Materials      RM-1                20,000               $1        $20,000

Materials             RM-2                 5,000                 5          25,000

                            RM-3                 3,000                 6           18,000

                            RM-4                  1,000                 8            8,000      $71,000

Work-in-process WIP-1                 6,000                10         60,000

                            WIP-2               8,000                 12         96,000   $156,000

Finished goods   FG-1                  1,000                65         65,000

                            FG-2                   500                88         44,000   $109,000

Total value of inventory                                               $336,000  $336,000

Inventory turnover = Cost of goods sold/Average inventory

= 19.3x ($6,500,000/$336,000)

Thus, the average inventory value is $336,000, while the inventory turnover was 19.3x.

Learn more about inventory turnover here: https://brainly.com/question/5701250

Help help help help help gekp

Answers

Answer:

I am pretty sure it is price of a new phone

On 12/31/Year 1 Passey Co. acquired a 100% interest inSolomon Co. by exchanging 10000 shares of its common stock for100000 shares of Solomons common stock. The fair market value ofPasseys common stock on December 31 Year 1 was $9 per share andthe fair value of Solomons was $3.50 per share.Additional information as of December 31 Year 1 is as follows:
Solomon Co.
Book Values Fair Values
Current assets $115000 $115000
Plant assets 200000 255000
Liabilities 10000 10000
Passey Co.Plant assets$1700000 $1800000
Passeys consolidated financial statements as of December 31 Year1 would report plant assets at:__________.
i. $1700000
ii. $1800000
iii. $1955000
iv. $2055000

Answers

The consolidated financial statements of Passey Co. as of December 31, Year 1 would report plant assets at iii. $1,955,000.

Data and Calculations:

Passey Co.s shareholding in Solomon Co. = 100%

The fair value of Solomon's = $3.50

The fair value of Passey's = $9

Solomon Co.

                                         Book Values   Fair Values

Current assets                      $115,000       $115,000

Plant assets                         200,000       255,000

Liabilities                                 10,000           10,000

Passey Co.

Plant assets                   $1,700,000 $1,800,000

Consolidated Plant Assets:

                                              Passey Co.   Solomon Co.  Consolidated

Number of shares exchanged  10,000          100,000

Plant assets                       $1,700,000      $255,000       $1,955,000

Thus, the consolidated financial statements of Passsey Co. as of December 31, Year 1 would report plant assets at iii. $1,955,000.

Learn more: consolidating plant assets of parent and subsidiary here: https://brainly.com/question/24635717

Dalia makes a little more money than she spends on her daily expenses and wants to put the extra away in a separate account in case she needs it for an emergency. Which type of account would be the best option for Dalia?​

Answers

the answer would be a savings account

What do you think the curves would look like in the next 100 years?

Answers

Answer:The last 100 years have seen a massive fourfold increase in the population, due to medical advances, lower mortality rates, and an increase in agricultural productivity made possible by the Green Revolution.

did this webside is working?

Answers

yes, it is webside working definitely

Market equilibrium is the _____ between businesses and consumers.

Answers

Answer:

A.compromise

Explanation:

:) hope its help

dentify the situation below that will result in a favorable variance. Multiple Choice Actual revenue is lower than budgeted revenue. Actual revenue is higher than budgeted revenue. Actual income is lower than expected income. Actual costs are higher than budgeted costs. Actual expenses are higher than budgeted expenses.

Answers

There are different ways firms generate revenues. The option that leads to favorable variance is when Actual revenue is higher than budgeted revenue.

Budget variance is known to be the difference between the budgeted amount of expense or revenue, and the actual amount.

The budget variance is said to becomes favorable when the actual revenue is higher than the budget or when the actual expense is less than the budget.

If revenue of a firm is higher than the budget or the actual expenses are less than the budget, this is known to be a favorable variance.

Learn more about Favorable variance from

https://brainly.com/question/15992453

Suppose that you are an orange grower. Would you expect the demand for your
orange to be more elastic or more inelastic? Why

Answers

It should be noted that the demand for orange will be elastic because when there's a change in price, there'll be a larger change in quantity demanded.

It should be noted that an elastic demand simply means a situation whereby a change in the price of a good lead to a larger change in the quantity demanded.

In this case, the demand for orange will be elastic because when there's a change in price, there'll be a larger change in quantity demanded. For example, an increase in price will make the customers buy other fruits.

Learn more about demand on:

https://brainly.com/question/25585026

Kline Construction is an all-equity firm that has projected perpetual earnings before interest and taxes of $628,000. The current cost of equity is 17.6 percent and the tax rate is 35 percent. The company is in the process of issuing $4.3 million of 8.3 percent annual coupon bonds at par. What is the levered value of the firm?

Answers

Based on the information given the levered value of the firm is $3,824,318.

First step is to calculate the Unlevered firm value

Unlevered firm value = EBIT(1 - Tax) / Cost of equity

Unlevered firm value= $628,000 x (1-.35)/.176

Unlevered firm value= $628,000 x (1-.35)/.176

Unlevered firm value = $628.000×.65/.176

Unlevered firm value = $2,319,318

Second step is to calculate Levered firm value

Levered firm value = Unlevered firm value + (Tax rate× Debt))

Levered firm value= $2,319,318 + (.35 x $4,300,000)

Levered firm value= $2,319,318 +$1,505,000

Levered firm value = $3,824,318

Inconclusion the levered value of the firm is $3,824,318.

Learn more about levered value here:https://brainly.com/question/20067496

Consider a favorite product or service of yours. What is it you value, and
what matters most? Can you develop clear requirements from this? And
Categorize your requirements revealed through the value you perceive into
‘Basic Quality’, ‘Spoken Performance’, and ‘Excitement Quality’ features,
2-2) And Taking your example from questions 1 put yourself in the place of
the supplier; how might you access customer requirements such as the
ones you noted?

Answers

Based on the information given, a favorite product of mine will be a mobile phone and it provides me with several values such as communication, taking pictures, etc.

The values that can be gotten from mobile phones will be communication, managing professional meetings, and emails, making purchases on online stores, capturing photos and videos.

Also, the most important feature of the mobile phone that I like is the camera and its connectivity.  The requirements that I like in a mobile phone include camera features, clarity of calls, and ease of access.

In conclusion, as a supplier, I will create a feedback mechanism in order to get information from consumers regarding the products.

Learn more about values on:

brainly.com/question/25528419

Prezario's has 25,000 shares of stock outstanding with a par value of $1 per share. The current market value of the firm is $847,000. Currently, the retained earnings account balance is $428,000 and the capital in excess of par value account balance is $187,000. The company just announced a 3-for-1 stock split. What is the common stock account balance after the stock split?

Answers

Based on the information given the common stock account balance after the stock split is $25,000.

Using this formula

Common stock account balance=Shares of stock outstanding× Par value

Where:

Shares of stock outstanding=25,000

Par value=$1

Let plug in the formula

Common stock account balance=25,000×$1

Common stock account balance=$25,000

Inconclusion the common stock account balance after the stock split is $25,000.

Learn more about common stock here:https://brainly.com/question/9970004

examples of non good services

Answers

Answer:

Examples of non-economic goods are air, water, sunshine, etc. The concept of non-economic goods is relative to place and time.

Explanation:

Non-economic goods are called free goods because they are free gifts of nature. They do not have any price and are unlimited in supply.

Help buissness help help help

Answers

answer is Mucus Fleming as he is a sports player. (:

Answer:

milton fredman

Explanation:

Miguel's lab group is conducting an experiment that involves dissolving different amounts of sugar and salt in test tubes. Which safety procedure is the MOSTappropriate for this experiment?

Answers

Answer:

Use a lead apron to protect against radiation.

Explanation:

Help help pelsss I need to pass thanks I’ll give points for honestly

Answers

What is the scenario? You need that in order to answer.

Scenario 1
A specific department within an organization has a high turnover rate; employees of this department
have a shorter average tenure than those of other departments in the company. Skilled workers are
leaving and the worker population contains a high percentage of novice workers. Ms Joyce Lynn has no
idea what is going on and wants to know more about what is happening.

Answers

Based on the information given, the researcher should proceed by finding the root cause of the problem.

From the complete question, the purpose of the study will simply be to find the be root cause of the problem firstly.

Also, the time horizon of the study should be taken into consideration. Furthermore, the research strategy that'll be applied in this case should be analyzed.

Learn more about research on:

https://brainly.com/question/6947486

Other Questions
a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet