the decisive battle of the war was fought at?
A. Yorktown
B.Charleston
C.Cowpens​

Answers

Answer 1
The decisive battle of the war was fought at Yorktown! A is the correct answer!
Answer 2

Answer:

An accurate description of the battle of Antietam is A. Deadliest day of fighting in the war. There were a couple of bombings and killing in this combat.


Related Questions

Ashley and Carin write an editorial in the Cougar Chronicle that rails against the injustice of morning announcements that constantly mispronounce their names. The school suspends them for writing such a negative editorial that was written specifically to attack someone.

Answers

The correct answer to this open question is the following.

Unfortunately, you did not include a question, just a statement. We do not know what you are asking.

We assume that you would like a comment about the Freedom of speech right, including in the Bill of Rights. If that is the case, we can comment on the following.

When Ashley and Carin wrote an editorial in the Cougar Chronicle that rails against the injustice of morning announcements that constantly mispronounce their names, they knew they were protected by the United States Constitution by freedom of speech right. This right is clearly stated in the 1st. Amendment to the US Constitution. Although the school suspended them for writing such a negative editorial that was written specifically to attack someone, the students know that it is its right to express themselves.

They had to consider that as members of the institution, they should have been more careful with their opinions because the institution has its own rules. However, as American citizens, they have the right to free speech.

Why did more women begin to complete high school in the late 19th century?

a
They had to graduate from high school in order to join a union.
b
They were allowed to keep their wages if they completed high school.
c
They received the same pay as men if they completed high school.
d
They sought to take jobs that required a high school education.

Answers

Answer: my personal answer would be

D They sought to take jobs that required a high school education

Women sought to take jobs that required a high school education.

Rise of Women's role in education in 19th century:Women began to join as teachers and as learners, the number of female teachers began to grow. Feminist leaders were highly active in promoting the education of women as teachers.Between 1890 and 1920, technological advances and economic policy changes began to change society’s view about children education.This allowed emphasis to be placed on the exclusive education of children during their childhood in America.

Therefore with the growth of economy along with rise in support of women education. Women in late 19th century begin to complete high school, so that they can sought to take jobs.

Learn More about Women Education: https://brainly.com/question/11649349

A. Hauser afirma que en las primeras décadas del Siglo XX hay un clima de época rupturista y de pesimismo cultural: ¿Qué quiere decir el autor? Luego, muestre una manifestación artística de alguna de las vanguardias de ese momento en la cual exista rupturismo y pesimismo, de alguna manera.

Answers

Answer:

Due to first world war.

Explanation:

Hauser stated that in the first decades of the 20th century there is a climate of disruptive times and cultural pessimism, the author mean in the statement that at that time life of the people of different nations are not good and they passes through a very hard times because in the first decades of the 20th century, first world war started which destroys the peace of the whole world and the people experience harsh times of their life.

PLEASEEE HELP ME GUYs!!!!
why was the North African campaign a “turning point” please give me the right answer because the teacher is blowing me

Answers

Answer:

The second battle of El Alamein, which began on 23 October 1942, was the turning point of the North African campaign - the longest and most important land campaign fought by New Zealanders in the Second World War.

Explanation:

Answer:

The second battle of El Alamein, which began on 23 October 1942, was the turning point of the North African campaign - the longest and most important land campaign fought by New Zealanders in the Second World War. Between 1940 and 1943 British and Commonwealth troops, together with contingents from occupied European countries and the United States, fought an ultimately successful campaign to clear North Africa of German and Italian forces.

Image has the answers to pick from please help.
What type of job was considered as unacceptable for women?​

Answers

Answer:

i believe the answer is c

Explanation:

Reasons why slavery was bad? I can't think of any.

Answers

I- Slavery was and still is bad because we all should be treated equal, the color of a person's skin doesn't matter at all; We all are human and should be treated like so!

Answer:

Slavery was bad because slaves were tortured, slaves didn't give their consent to be a slave, were treated unfairly and unequally and were seprated from their families. Slavery is an inhumane act which is why its bad.

Explanation:

Stephen F. Austin was used to being able to speak his mind in the United States, but Mexico didn't have the same type of freedom of speech in their country. In your journal, discuss whether or not you feel Americans today take our rights and freedoms for granted.

Answers

The correct answer to this open question is the following.

Stephen F. Austin was used to being able to speak his mind in the United States, but Mexico didn't have the same type of freedom of speech in their country.

I feel Americans today take their rights and freedoms for granted because they were born with these rights and do not appreciate the value of it.

Although in those years of Stephen F. Austin's time, freedom of speech was not like the one in the United States, today México and other Latin American countries indeed have the same freedom of speech as the democratic countries they are.

The difference is that the American people have forgotten the cost of having that freedom of speech in the United States Constitution. They do not have in mind the many wars the nation has fought and the many deceased people in those battles that fought for liberty and the freedom of speech.

Answer:

Yes, I feel like Americans today take our rights and freedoms for granted because, in this situation, most people are lost because they usually go outside mask free and meet up with friends and hug and touch each, but now they can barely see them, so yes I feel like Americans take our rights and freedoms for granted.

Explanation:

name all the factors that lead to the fall of rome

Answers

Answer:

1. Military- The Roman Army became weaker and less loyal to the Roman Empire. The army was not able to stop the barbarian invasions

2. Political- The government became corrupt, oppressive, and self centered. It lost popular support and the people did not have confidence in its leaders.

3. Economic- Taxes increased and the population declined because of disease and war. The empire relied too heavily on slave labor.

4. Social- There was a decline in patriotism, discipline, and devotion to duty. The upper class became self- centered and concerned with their own luxuries and wants. There was a decline in the size of the middle class and the gap between the upper and lower classes widened. The people became lazy and they lost the value of self- reliance.

- I hope this helps have a great night!

In the 1920s, eugenics was used to justify—

Answers

Answer:

Anti-Miscegenation Laws

Explanation:

Eugenic considerations also lay behind the adoption of incest laws in much of the U.S. and were used to justify many anti-miscegenation laws. [44] Stephen Jay Gould asserted that restrictions on immigration passed in the United States during the 1920s (and overhauled in 1965 with the Immigration and Nationality Act) were motivated by the goals of eugenics.

Answer:

it was used to justify by breeding out people with diseases and disabilities and other characteristics that were 'undesirable' and people that agreed with this thought that those type of people were to be bred out of the gene pool

Explanation:

What is a totalitarian leader?

Answers

Answer:

Totalitarianism is a form of government that attempts to assert total control over the lives of its citizens. It is characterized by strong central rule that attempts to control and direct all aspects of individual life through coercion and repression.

Explanation:

just search on google

What geographical feature helped New England
colonists?

Answers

Answer:

The correct answer is B) mountains

Explanation:

The Geology of North America includes many mountains, and it is thick with trees, rivers and oceans. The forest provided large amounts of lumber for New England and led them to specialize in the shipbuilding industry. However, the landscape was unsuitable for cereal crops, so they were imported from the other colonies.

During the one hundred years following the original treaties between the US government and American Indian tribes, treaties

-were no longer sought.
-successfully prevented conflict.
-were broken or ignored by many.
-were successfully attempted.

Answers

Answer:

Were broken and ignored by many

Explanation:

While America promised to give American Natives land, they continuously pushed them farther and farther west.

Answer:

C

Explanation:

PLEASE HELP!!!!!!!!
how was the U.S. at war with itself in the 1960s (before 1968)

Answers

They were at ease with the war being over

1
Which European country was conquered by the Islamic Empires?
A.
France
В.
Italy
с.
Greece
D
Spain

Answers

Answer:

D

Explanation:

The answer to Wich European was counquered by the islamic empires

Which of the following is a characteristic of a free market company?

A. Individual choice

B. Centralized planning

C. Government influence in the private sector

D. Community ownership of resources

Answers

A. Individual choice

Question 12
which event was the result of the Spanish American war?

Answers

it’s the second answer

Can u guys help me pls

Answers

Answer:

its basically where the branches of government check to make sure that no branch is more powerful then the other, an example is that the president can veto a bill but 2/3 vote in congress can override it, another example is that the house of representatives has the power of impeachment but the senate has power to try any impeachment

also the answer will be marked wrong when you look at the score but thats because the teacher has to actually read what you put

What were the two reasons
why Muhammad was met
with hostility?



I need help asap less than 15 minutes plz

Answers

Answer:

As Islam spread in Mecca, the ruling tribes began to oppose Muhammad's preaching and his condemnation of idolatry. The Quraysh tribe controlled the Kaaba and drew their religious and political power from its polytheistic shrines, so they began to persecute the Muslims and many of Muhammad's followers became martyrs.

Explanation:

Answer: when prophet Muhammad arrived to McConaughey he destroyed the idols in the Kaaba and had the call to prayer made from its roof.

Explanation:

The​ short-run effect of an increase in the supply of money is A. an increase in both real Gross Domestic Product​ (GDP) and the price level. B. an increase in the price level but not in real Gross Domestic Product​ (GDP). C. an increase in the price​ level, a decrease in real Gross Domestic Product​ (GDP), but an increase in nominal national income. D. an increase in real Gross Domestic Product​ (GDP) but not in the price level.

Answers

Answer:

A. an increase in both real Gross Domestic Product​ (GDP) and the price level.

Explanation:

Based on various economic theories, the​ short-run effect of an increase in the supply of money leads to increased or more availability of money for lending and borrowing, and higher rates of spending, which then equates to more production level at local markets and thereby ultimately lead to increased in country's GDP (Gross Domestic Product)

Hence, in this case, the correct answer is "A. an increase in both real Gross Domestic Product​ (GDP) and the price level."

Answer:

A. an increase in both real Gross Domestic Product​ (GDP) and the price level.

Explanation:

edg

What was the impact on religion of the scientific discoveries made during the Scientific Revolution?
A.
The power of the church in Europe weakened, and science began to become a secular field.
B.
The church gained support from the scientists to promote the teachings of Aristotle.
C.
The scientists spent more time researching the role of God in the universe.
D.
The church became even more responsible for spreading the new scientific discoveries.
E.
The power of the church in Europe was completely eliminated, which fostered scientific progress.

Answers

Answer:

A.)The power of the church in Europe weakened, and science began to become a secular field.

Answer:

FOR PLATO answer is .a

Explanation:

Which of the following events is a direct result of industrialization

Answers

Answer:

C

Explanation:

The industrial revolution was the force behind the New Imperialism, as it provided funding for wealthier European nations to expand their territories. They also searched for places rich with the materials they needed for their businesses and for new market places for their goods.

help 100 point and brainly



They created war and a whole convention to write to the king about it. solution

Answers

Answer:

9th grade and I am not sure what

Explanation:

9th grade and I am not sure what I will

What is the full question pls and thanks

Do the positives from imperialism outweigh the negatives?

Answers

Answer:

I think the positive effects of imperialism outweighed the negative impact. Although many people died from disease, lost their land and independence, breaking down of their traditional cultures and division of the African continent, still the positive effects are more useful and efficient in now days.

Answer:

I think the positive effects of imperialism outweighed the negative impact. Although many people died from disease, lost their land and independence, breaking down of their traditional cultures and division of the African continent, still the positive effects are more useful and efficient in now days.

Explanation:

i need those points bro

Which issue most likely influenced the voting pattern on the map?
A) Battle of the Alamo

B) Expansion of slavery

C) Competition for rail lines

D) Threat of war with Spain

Answers

Answer:

The answer is D

Explanation:

Mexico wanted to keep Texas

7. Briefly describe the (1) nationalities, (2) motivations for trade, and (3) Impacts of the following explorers:
· Bartolomeu Dias, Vasco de Gama, Ferdinand Magellan, Christopher Columbus

Answers

Answer:

Bartolomeu Dias - a nobleman of the Portuguese royal household, was a Portuguese explorer. He sailed around the southernmost tip of Africa in 1488, the first European to do so, setting up the route from Europe to Asia later on.

Vasco de Gama -  1st Count of Vidigueira, was a Portuguese explorer and the first European to reach India by sea. His initial voyage to India was the first to link Europe and Asia by an ocean route, connecting the Atlantic and the Indian oceans and therefore, the West and the Orient

Ferdinand Magellan - a Portuguese explorer who organised the Spanish expedition to the East Indies from 1519 to 1522, resulting in the first circumnavigation of the Earth, which was completed by Juan Sebastián Elcano.

Christopher Columbus - an Italian explorer and navigator who completed four voyages across the Atlantic Ocean, opening the way for European exploration and colonization of the Americas.

Provide an explanation and real world example for each of the seven articles in the Constitution.

Answers

Answer:

Article one - The legislative branch - To make laws - I am going to make a law that says we should be able to go in the desert whenever.

Article two - The executive branch - carries out laws - we should make sure the law that we can go in the desert true.

Article three - the highest court in all the articles - I will let everyone do everything that they want.

Article four - the states - make freedom - I will put all the bad guys in jail.

Article five - Admendment - To make things right - I will make sure nothing happens.

Article six - Depths, supremery, oaths - holds constitution under depths - I will make sure that no depths are found.

Article seven - ratifacation - make sure the moneys good - I will make sure the money does not run out.

Explanation:

Please help ASAP!!! will give brain list to the person with the right answer ​

Answers

Answer:

I think its D but I'm not 100% sure or probably B I think B is your best bet  

Explanation:

Answer:

B.

Explanation:

Controlling the system of taxation would have not brung much power and would just screw with the amount of taxes gained by the goverment.

Hi, I have a question?, so i have been seeing so many muslims now, and I dont know how i think of them so.... I just wanna ask what do u think about muslims?? Bc most people say they arent good to be around, and that they are terrorists. so are they??

Answers

Answer:

Heck no

Explanation:

Thats just a stereo type dont buy into that

Answer:

They're not terrorists, they're people.

Explanation:

I think before you judge a person, you have to learn about their personality first. Otherwise, you might use someone else's opinion, stereotypes, or some dum.b rumor to judge a person before you have your own opinion of that person.

If you don't like them, that's fine, but it should be based off of your own views.

Egyptians invented a new form of writing called _______.
a.
cunneiform
c.
papyrus,
b.
hieroglyphs
d.
the alphabet

Answers

Answer:

B ( this is so I can get 20 characters)

Answer:Hyroglyphica

Explanation:

When archeologists first studied Egyptian hieroglyphics they thought that each symbol represented a word. ... A symbol can represent a word, a sound, a syllable, or a concept. Words. In some cases, the symbol represents a full word. These symbols are called ideograms or logograms.

During the Lewis and Clark expedition,

Sacagawea and her child helped smooth relations with American Indians.
the explorers found a water route from the Atlantic to the Pacific.
the explorers ignored the natural world and focused on American Indians.
many skilled people of the frontier helped to smooth relations with American Indians.

Answers

Answer:

Answer is A: Sacagawea and her child helped smooth relations with American Indians.

Explanation: We go 100%

Answer:

A

Explanation:

Edge

Other Questions
4. Discuss the role of necrohormones Let f(x) = 9x and g(x) = x + 7. What'sthe smallest number that is in the domain offg?Enter the correct answer.OOOODONEClear all what was the strength and weakness of Adam Smith and David recardo A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest?