TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer 1

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.


Related Questions

PLS HELP!!!
During science class, Sofia drew a picture similar to the one above. Which phrase would appear in the caption box on the right side of the figure?

Group of answer choices

low sound

long wavelength

short wavelength

low frequency

Answers

Answer: low sound

Explanation:

What is a global hectare (gha)?

Answers

Accounting unit of ecological protection

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

Which of the following environmental parameters would be important to monitor in order to ensure sustainable logging?

A. The number of trees cut down versus number trees burned
B. The number of new trees planted to replace those removed
C. The number of trees needed to increase soil fertilization
D. The number of trees removed within a single species

Answers

Answer:

B. The number of new trees planted to replace those removed

Explanation:

Because to ensure that logging is sustainable, they have to sustain a certain ratio of trees cut down, to trees planted. D. The muber of trees removed within a single species could be right, but I think B is more right.

If you get this wrong you can blame it on me.

Answer:

The number of new trees planted to replace those removed

Explanation:

What is the process of Asexual and Sexual reproduction of Jellyfish?
Plz give BOTH answers!!

Answers

Answer:Jellyfish reproduction involves several different stages. In the adult, or medusa, stage of a jellyfish, they can reproduce sexually by releasing sperm and eggs into the water, forming a planula.

sexual is when there is a mom and dad and a sexual is when a single organism gives birth usually they look the exact same as the species  

Explanation:

What was Anna Garcia wearing when she died? 2020

Answers

Answer is she was walking her dog in a sweater despite the current heatwave.

8. What are NAD+ and FAD? What do they become?

Answers

Answer:

What are NAD+ and FAD? ... They become NADH AND FADH2 when they pick up the hydrogens during Glycolysis (NADH only), and the Krebs Cycle.

Answer:

syteysertersgeg

Explanation:

Describe the structure of the conjugated protein
haemoglobin, with reference to the levels of protein
structure.

Answers

Answer: Answer below, hope this helps! :D

Explanation:

A conjugated protein is a protein that functions in interaction with other (non-polypeptide) chemical groups attached by covalent bonding or weak interactions. ... The non-amino part of a conjugated protein is usually called its prosthetic group. Most prosthetic groups are formed from vitamins. Hemoglobin is a protein having a globular structure. Based on its structural properties, hemoglobin can be divided into two parts; a protein part and a heme group. The structure of the protein part can be studied at four levels; primary structure, secondary structure, tertiary structure, and quaternary structure.

Which of the following is a true statement?

The oceans replenish groundwater.
Lakes are only found in the Northern Hemisphere.
Coral reefs and sandbars create lagoons.
The oceans provide water for rivers and streams.

Answers

Answer:

Coral reefs and sandbars create lagoons.

Explanation:

↑↑↑↑↑↑ the one above is the answer

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

If the sodium/potassium ion pump were to stop functioning, what would eventually happen to the concentration gradients of sodium and potassium ions across the membrane

Answers

Answer:

The correct answer would be - concentration gradient will reach to equilibrium.

Explanation:

If the Na+/K= ion pump stops working which is to pump the sodium and potassium ion across the cell membrane. The movement takes place in 3:2 ratio with the help of ATP.

Eventually, the concentration gradients of sodium and potassium would be equal and found equilibrium across the membrane. This equilibrium would be reached due to passive transport that occurs in either direction across the membrane.

tRNA molecules deliver amino acids to ribosomes where the amino acid next
A. forms an ionic bond with another amino acid
B. is deaminated and catabolized
С. becomes an anticodon
D. is covalently bonded to a growing polypeptide
E. forms hydrogen bonds with esters

Answers

Answer:

tRNA molecules deliver amino acids to ribosomes where the amino acid next becomes an anticodon (option C).

Explanation:

A tRNA molecule is able to deliver amino acids to the ribosomes for protein synthesis, forming an anticodon that complements the codon of the mRNA being translated. The mRNA molecules are responsible for conducting the genetic code —obtained from DNA transcription— to be translated by the ribosomes. This code is established by sequences of three nucleotides, called codons, which encode different amino acids.

What happens when mRNA molecules expose codons to ribosomes is that a tRNA molecule containing a complementary anticodon is formed, which is conducted to the ribosome to bind to the codon. This allows, according to the genetic code, the formation of a protein with a specific sequence of amino acids.

tRNA molecules deliver amino acids to ribosomes where the amino acid  - С. becomes an anticodon.

During translation tRNA, molecules deliver amino acids to the ribosome and bind to this codon. It is a complementary anticodon to this codon.

Each tRNA molecule has two distinct endsone end binds to a specific amino acidthe other which binds to the corresponding mRNA codon. The first tRNA transfers its amino acid to the amino acid on the newly arrived tRNA, and a chemical bond is made between the two amino acids.

Thus, tRNA molecules deliver amino acids to ribosomes where the amino acid  - С. becomes an anticodon.

Learn more:

https://brainly.com/question/13887888

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

which image shows a non renewable resource?
1
2
3
4

Answers

I think it’s 1

because non renewable resource is gas, Oil, nuclear energy, and natural gas.

To find new and alternative farming methods and practices, private companies often fund their own research and development teams.


False

True

Answers

I think the answer is false

:):):):):)

Answer:

FALSE ALL DAY LONG

Explanation:

In those parts of equatorial Africa where the malaria parasite is most common, the sickle-cell allele constitutes 20% of the b hemoglobin alleles in the human gene pool. In the United States, the parasite that causes malaria is not present, but African-Americans whose ancestors were from equatorial Africa are present. What should be happening to the sickle-cell allele in the United States, and what should be happening to it in equatorial Africa

Answers

Answer:

directional selection, stabilizing selection

Explanation:

Directional selection is a type of natural selection that favors one extreme phenotype over other phenotypes, thereby modifying allele frequency in the direction of the favored phenotype. This type of positive selection is the main cause of phenotypic diversification. In the USA, the environment created a selection pressure that favored individuals that don't have the defective sickle-cell allele, thereby reducing its frequency in this population. Stabilizing selection, also known as balancing selection, is a type of natural selection where the most common phenotype is selected in the population, thus predominating in future generations. In equatorial Africa, the defective sickle-cell allele is present in a high frequency because individuals that are heterozygous for this allele are less susceptible to malaria, and therefore balancing selection should maintain this allele in the African population.

How can the environment affect an organism’s traits? Give two examples please!

Answers

Answer:

An organism will adapt to survive an environment. For example if an environment is very cold the organism will develop a thicker coat to trap in heat. Another example is if it is an environment with many trees, an organism might develop claws to climb trees or a tail to assist with balance and climbing

Explanation:

Hope this helps :)))

Plant cells are different from animal cells because they are usually -

Answers

A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. Animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. Animal cells have a cell membrane, but NO CELL WALL.

Answer:

Plant cells have a large, singular vacuole that is used as a storage and to maintain the shape of the cell.  Even though animal cells have vacuoles, they are smaller.  Plant cells have a cell wall and a cell membrane.  Animal cells only have a cell membrane, and no cell wall.

Explanation:

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

SUBJECT SCIENCE: how could the rocks from the Rocky Mountains and the Great Plains have such similar composition? (WRITE AT LEAST 5 SENTENCE)

Answers

It might also be possible that the rock of the Rocky Mountains formed from the rock of the Great Plains if the Great Plains rock were somehow carried underground to where energy from Earth's interior could melt it into magma. Matter gets transformed by energy, but the same matter is still present.

At what points in the progression from gene to protein do these methods act (i.e., what processes do they prevent)

Answers

Answer:

Genes are translated, transcribed and after these two steps, the formation of a protein takes place.

DNA is translated, that is, read, in the form of codes and thanks to the machinery of intracellular transcriptases, after this an RNA is encoded that will be made with the assembly of amino acids that together will form proteins.

Proteins can be structural or functional.

Explanation:

There are different methods to intervene in these processes, it can be by means of macromolecules, drugs and also by microbiological factors, that is, by microorganisms such as viruses that take advantage of the human transcription machinery to replicate.

What's the definition of absoulute dating

Answers

Absolute dating is the process of determining an age on a specified time scale in archaeology and geology. Some scientists prefer the terms chronometric or calendar dating, as use of the word "absolute" implies an unwarranted certainty and precision. Absolute dating provides a numerical age or range in contrast with relative dating which places events in order without any measure of the age between events. In archeology, absolute dating is usually based on the physical, chemical, and life properties of the materials of artifacts, buildings, or other items that have been modified by humans and by historical associations with materials with known dates. Techniques include tree rings in timbers, radiocarbon dating of wood or bones, and trapped charge dating methods such as thermoluminescence dating of glazed ceramics. Coins found in excavations may have their production date written on them, or their may be written records describing the coin and when it was used, allowing the site to be associated with a particular calendar year.

Which of the following metals can be used as a fuel?

Answers

Answer:

Is ther supposed to be a list or a picture ?

Explanation:

Uranium is can be used as a fuel especially in reference to radioactivity and how it gives of energy.

Plant cells are different from animal cells because they are usually

Answers

A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. In contrast, animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. Animal cells simply have a cell membrane, but no cell wall.

I CANT FAIL PLEASE SOMEBODY
If the brown bears’ reliance on leaves increased by 14 percent, how would the combined total of all the percentages be affected?

It would increase by 14 percent.

It would decrease to 86 percent.

It would remain at 100 percent.

It would change to 114 percent.

Answers

Answer:

It would remain at 100%

Explanation:

The whole won't change-

just the percentages of the separate pieces of diet would change

provide more than double the energy provided by carbohydrates or proteins in human body.
a:vitamins
b:fats
c:minerals
d:starch​

Answers

I'm not too sure which one of these two but its either A or C
i think the answer would be a :)))

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

triangular shaped land mass found on land ​

Answers

Answer:

beautiful

Explanation:

serioudly I like it

Deltas are beautiful landforms, especially when viewed from above. Roughly triangular in shape, deltas are full of complex, wonderful detail: swirling, multi-colored sediments broken by serpentine, miniature river channels.

Which of these are characteristics of all three main groups of worms? Check all that apply.

They lack nerve cells.
They can reproduce sexually.
They display bilateral symmetry.
They have a single tissue layer.
They are invertebrates.
Multiple choice

Answers

They lack nerve cells, They display bilateral symmetry, They are invertebrates. A, C, E

Answer:

they can reproduce sexually

they display bilateral symmetry

they are invertebrates

Explanation:

Summarize the roles of glucose and ATP in
energy processing.

Answers

Answer:

Summary. Glucose is the carbohydrate produced by photosynthesis. Energy-rich glucose is delivered through your blood to each of your cells. ATP is the usable form of energy for your cell

Other Questions
Ummmmmmmmmwhat is the second largest country in the world (by land area) What is the multiplayer for a 3% increase? If UW = 9x -9, what is UW in units? x2=120solve for the exact variable answer Simplify as fully as possible4xy^4 (3xy) / 2xy4xy^9 what would happen if an electric fish was always negatively charged instead? A right cylinder has a diagonal length of 37 and a total surface area of 492.What is the height of the cylinder? A. 35B. 42C. 25D. 17E. 32 In researching his history report about the Civil War, why is Ariq most likely to use secondary data than primary data? does confining stress increase volume Which of the following describes light? (SELECT ALL THAT APPLY.)A. Light passes through all objects.B. Light is reflected off the surface of mirrors.C. Light travels in a straight line.D. Light waves behave in predictable ways. what was the result of the issue from the election of 1800? Which tables represent linear functions of x?Xy11X 1 12 B 4-21X Y1 52 C 103 152 A-48WN3-63927 A. 5/7 piB. 4/9 pi C. 6/7 piD. 2/3 piE. 5/9 pi Evaluate 18a+5 when a=3.18a+5= Which of the following best describes current Palestinians?a. working hard to prevent further warsb. controlling the West Bank and Gazac. moving into areas along the Suez Canald. do not have a homeland and are rebelling against Israel can I please have some help A patient needs a total dose of 50 grams of albumin. The pharmacy has 50 mbottles of 25% Albumin in stock. How many bottles should the pharmacytechnician prepare to provide the required dose? What is Y=3x^2+6x+10 in vertex form. What are chromosomes? How are they different between prokaryotes and eukaryotes? I need help again pls.