SUPER URGENT: Complete the general form of the equation of a sinusoidal function having an amplitude of 6, a period of 2pi/3, and a phase shift to the left 1 unit.

y =

SUPER URGENT: Complete The General Form Of The Equation Of A Sinusoidal Function Having An Amplitude

Answers

Answer 1

Answer:

y = 6·sin(3·(x - 1)) + c

Step-by-step explanation:

The general form of an equation for a sinusoidal function is presented ad follows;

y = a·sin(b·(x - h) + c

Where;

a = The amplitude of the equation

T = The period = 2·π/b

h = The phase shift

c = The vertical shift

From the question, we have;

a = 6,

2·π/3 = 2·π/b

∴ b = 3

h = 1

We get;

y = 6·sin(3·(x - 1)) + c.


Related Questions

HELPpppp

A standard deck of 52 playing cards contains 13 cards in each of four suits: hearts, diamonds, clubs, and spades. Four cards are drawn from the deck at random.

What is the approximate probability that exactly three of the cards are diamonds???

Answers

Answer:

0.25 is the probability

Step-by-step explanation:

If there are 13 diamonds in a deck of 52 cards, dividing 13 by 52 will get you 0.25. This is the probability of getting a diamond from the deck of 52 cards.

a cell phone plan charges a base fee of $62 and an overage charges $30 per gigabyte of data that exceeds 2 GB​

Answers

I will draw a new chapter for the first chapter of class in chapter chapter class ti

The following triangle is and

isosceles
scalene
equilateral
——————
right
acute
obtuse

Answers

Answer:

isosceles

right

Step-by-step explanation:

The two legs (not the hypotenuse) are marked as equal. So the triangle is at least isosceles (choice of the top three)

The square in the bottom left corner is used as the symbol for a right angle. So this triangle is a right triangle.

What is the factorization of 49b2 − 81?

Answers

Step-by-step explanation:

The factorisation of 49b^2 - 81 is (7b - 9)(7b + 9). This is because 49 and 81 are the squares of 7 and 9 respectively, so these must be multiplied together. b^2 is b x b. Finally, it must be -9 and +9 to make -81, because when the signs are the same the result is a positive number

Answer:

(7b - 9)(7b + 9)

Step-by-step explanation:

49b2 - 81

49 - 7 x 7

b2 - b x b

81 - 9 x 9

(a + b) (a - b) = a2 - b2

(7b - 9)(7b + 9)

A triangle has sides with lengths of 5 kilometers, 11 kilometers, and 12 kilometers. Is it a right triangle?

Answers

Answer:

Step-by-step explanation:

to prove it right angle

square of largst side must be eqaul to the sum of two other sides.

so here 12 is largest and 11 and 5 are two other smallest sides of a triangle.

(12)^2=(11)^2+(5)^2

144=121+25

144=146

since the square of largest side is not equal to the sum of square of other two smaller sides it can be concluded that the given sides of a triangle does not form a right angled triangle.

angles 1 and 2 are completely and congruent what is the measure of angle 1

Answers

Answer:

180

Step-by-step explanation:

If the awnsers are equal and make a full 360 angle, the angle of one of them is 180 because that is half of 360.

Every point on a circle is the same distance from a single location. What is
that location called?

Answers

Answer:

The center.

Step-by-step explanation:

That point is the center of the circle.

Hope that this helps!

There are x students trying out for a solo in a chorus concert. Only 6 will be chosen. How many students will not be chosen? Please write down the Algebra expression and answer please and thank you.

Answers

We need to solve this question using Algebraic expressions. The answer for the given question is x-6.

How do you solve Algebraic Expressions?

A mathematical expression with variables and/or numbers is called an algebraic expression. It can be simplified even if it cannot be solved since it lacks an equals sign (=). Algebraic equations, which have algebraic expressions divided by an equals sign, can be solved. Recognize the distinction between an algebraic equation and an algebraic expression. A mathematical expression called an algebraic expression can have variables or integers in it. be able to combine similar phrases. Adding up (or removing) the terms with the same degree is all that is required to combine related terms. All x2 terms can be mixed with other x2 terms, and all x3 terms can be coupled with x3 terms, according to this.

Calculation

x students are trying in a chorus concert.

Only 6 students will be chosen.

        so the answer for the given question=x-6

We need to solve this question using Algebraic expressions. The answer for the given question is x-6.

To  refer more about Algebraic expressions, visit:

https://brainly.com/question/4344214

#SPJ1

A small auditorium has 20 seats in the first row and each successive row contains 2
additional seats. If there are 12 rows in the auditorium, how many seats are in this
auditorium?
O 384
O 372
O 330
O 264

Answers

Answer:

330.

Step-by-step explanation:

Count all the way up. The first row is 20, then goes, 22,24,26,28,30,32,34,36,38,40. These are the number of seats for all 12 rows, since we added 2 each row. Add them all together including 20 to get 330 seats. The whole auditorium has 330 seats.

Hope this helps!

As per arithmetic Progression, there are 372 seats in the given auditorium.

What is an arithmetic progression?

"Arithmetic Progression is a sequence of numbers in order, in which the difference between any two consecutive numbers is a constant value."

Given, the auditorium has 20 seats in the first row.

Then, each successive row contains 2.

We can assume it as an arithmetic progression.

Here, the first term(a) is 20.

The common difference(d) is 2.

Total number of terms(n) is 12.

Therefore, the sum of all the terms is

[tex]= \frac{n}{2}[2a + (n-1)d]\\= \frac{12}{2}[2(20) + (12-1)2]\\= 6[40+(11)2)]\\= 6(40+22)\\= 6(62)\\= 372[/tex]

Learn more about an arithmetic progression here: https://brainly.com/question/20733446

#SPJ2

3. Solve the system of equations without graphing. Show your reasoning.
ſ 2y = x - 4
4x + 3y = 5

Answers

Answer:

X=2, y=-1

Step-by-step explanation:

2y=x-4 equation 1

4x+3y=5 equation 2

x=2y+4 isolate x in equation 1

4(2y+4)+3y=5 substitute value of x from equation 1 into equation 2

8y+16+3y=5

11y=-11

y=-1

solve for x by inputting y value into either equation

2y=x-4

2(-1)=x-4

-2=x-4

2=x

What is least common multiple of 15, 14, and 7

Answers

Answer:

210

Step-by-step explanation:

15 = 3 x 5

14 = 2 x 7

7 = 7

LCM = 3 x 5 x 2 x 7 = 210

Answer:

210

Explanation:

find the least common multiple of two numbers is to first list the prime factors of each number. Then multiply each factor the greatest number of times it occurs in either number. If the same factor occurs more than once in both numbers, you multiply the factor the greatest number of times it occurs.

Find a number which in which added square
sum will be 72.​

Answers

Answer:

8.48528137424^2

Step-by-step explanation:

8.48528137424x8.48528137424

= 72

What is the solution to the equation fraction 1 over 4 x = 5? (5 points) x = fraction 4 over 5 x = fraction 5 over 4 x = 20 x = 1

Answers

Answer:

your question was barely readable, but I'll try it anyways. hope it helps you to understand the concept.

[tex] \frac{1}{4} x = 5[/tex]

multiply each side of the equation by 4

[tex]x = 20[/tex]

sorry, the test really doesn't make much sense as a question. try to photograph the problem if possible. but take care not to photograph personal information

57.
Peter shared the cost of dinner equally with 3 of his friends. When he was calculating the
amount that each of them should pay, he divided the cost by 2 instead of 4. In the end, each
boy paid $11.40. Find the correct amount for each share.

Answers

Answer:

$5.70

Step-by-step explanation:

→ Find the total amount they needed to pay

11.40 × 2 = 22.80

→ Divide the total by 4

22.80 ÷ 4 = $5.70

an architects cWhat is the domain of this relation?

(12, 5)
(20, 0)
(20, 20)
(–13, 0)

Answers

Answer:

Domain { -13,12,20 }

Step-by-step explanation:

The domain is the input values

Domain { -13,12,20 }

We list them in order from smallest to largest and do not list repeats

What is the period of the graph of y
5cos(4x + 1) + 3?

Answers

Answer:

period=(2π-1)/4

Step-by-step explanation:

4x+1=2π

4x=2π-1

x=(2π-1)/4

Answer:

Period is [tex]\frac{\pi}{2}[/tex]

Step-by-step explanation:

For the function [tex]y=acos(bx-c)+d[/tex], the period is [tex]\frac{2\pi}{|b|}[/tex].

Therefore, the period of the function is [tex]\frac{2\pi}{|b|}=\frac{2\pi}{|4|}=\frac{2\pi}{4}=\frac{\pi}{2}[/tex].

What this means is that the function's wave cycle will repeat every [tex]\frac{\pi}{2}[/tex] units.

Can someone help me please?

Answers

Step-by-step explanation:

Given that,

No. of heads = 40

No. of tails = 60

We know that,

Probability = (no. of favourable outcomes)/(total no. of outcomes)

Experimental probability of getting heads,

no. of favourable outcomes = 40

Total no. of outcomes = 40+60 = 100

So,

[tex]P=\dfrac{40}{100}[/tex]

She has taken 60 on denominator. She should have taken 100 instead of 60.

what is the length of BC?
A. 9 units
B. 11 units
C. 15 units
D. 16 units​

Answers

Answer:

15units

Step-by-step explanation:

BC is: 5x=5×3=15 units. so,Length of BC=15 units

Please help me with this problem

Answers

Answer:

3.14 x 4 x 4

= 3.14 x 16

= 50.24

Answer:

50.24

Step-by-step explanation:

A=πr²

  = (3.14)(4)²

  = 50.24

Whats the measure of

Answers

Answer:

C. 80°

Step-by-step explanation:

Recall: SOH CAH TOA

Reference Angle = J

Opposite = 60

Adjacent = 11

Hypotenuse = 61

Apply trigonometric function, SOH, which is:

Sin J = Opp/Hyp

Sin J = 60/61

[tex] J = sin^{-}(\frac{60}{61}) [/tex]

J = 79.6111422°

J = 80° (nearest degree)

Which of the following is furthest to the left on the number line?
-6.5
-5
-6.7
-6 help mee

Answers

Answer:

6.7 is farthest to the left of the line

Analyze the diagram below and complete the instructions that follow.

Find the exact value of tan(M).

Answers

Answer:  5/12  (choice C)

Explanation:

Recall that tangent = opposite/adjacent.

For reference angle M, the side ON = 5 is the opposite side and MN = 12 is the adjacent side. We don't need the hypotenuse.

Answer:

C or 5/12

Step-by-step explanation:

Which graph represents
y= -2x?

Answers

it would be the second graph since the coefficient is negative

Answer:

The second one

Step-by-step explanation:

The length of a rectangle is 5 more than 3 times the width. Write and solve an equation to find the width (w) if the length is 12.5 cm.

Answers

Answer:

Length = 42.5 cm

Step-by-step explanation:

length of rectangle = 5 + 3w

So l = 5 + 3w where w = 12.5

Equation:

L = 5 + 3(12.5)

Solving the Equation:

L = 5 + 3(12.5)

L = 5 + 36 + 1.5

L = 42.5

Length: 42.5 cm

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

if sec theta = 5/3 and the terminal point determined by theta is in quadrant 4, then:​

Answers

Answer:

A. csc 0 = -5/4 or B. cos 0 = 3/5

Answer:

B or A

Step-by-step explanation:

sec(theta) = 1/cos(theta)

cos(theta) = adjacent side / hypotenuse.

The csc(theta), the sin(theta) and the tan(theta) in quad 4 are all minus

Since the cos(theta) is positive in quad 4, B is going to be the answer.

The value for sin(theta) should be sin(theta) = - 4/5 not 2/5

Tan(theta) = - 4/3

Note: 4 is found by using the Pythagorean Theorem because the trigonometric functions are all defined by the sides of a right triangle.

a^2 + b^2 = c^2

a = the adjacent side = 3

b = the opposite side = b

c = the hypotenuse = 5

3^2 + b^2 = 5^2

9 + b^2 = 25

b^2 = 16

b = 4

The sum of 4 and y divided by 5 equal to 9. Find the value of y.​

Answers

Answer:

y = 41

Step-by-step explanation:

When you add 41 and 4, you would get 45.

When you divide by 5, it will be equal to 9:

45 ÷ 5 = 9

---------------------------------------------------------------------------------------------------------------

Have a great summer :)

The image of a parabolic lens is projected onto a graph. The image crosses the x-axis at –2 and 3. The point (–1, 2) is also on the parabola. Which equation can be used to model the image of the lens?

y = (x – 2)(x + 3)
y = (x – 2)(x + 3)
y = (x + 2)(x – 3)
y = (x + 2)(x – 3)

Answers

Answer:

[tex]y =-\frac{1}{2}(x +2)(x - 3)[/tex]

Step-by-step explanation:

Given

[tex]x_1 = -2[/tex]

[tex]x_2 = 3[/tex]

[tex](x,y) = (-1,2)[/tex] --- a point on the parabola

Required

The equation

First, calculate the equation from the zeros

[tex]y =k(x - x_1)(x - x_2)[/tex]

Substitute [tex]x_1 = -2[/tex] and [tex]x_2 = 3[/tex]

[tex]y =k(x - -2)(x - 3)[/tex]

[tex]y =k(x +2)(x - 3)[/tex]

To solve for k, we substitute [tex](x,y) = (-1,2)[/tex]

[tex]2 = k(-1+2)(-1-3)[/tex]

[tex]2 = k(1)(-4)[/tex]

[tex]2 = -4k[/tex]

Divide by -4

[tex]k=\frac{2}{-4}[/tex]

[tex]k=-\frac{1}{2}[/tex]

So, the equation is:

[tex]y =k(x +2)(x - 3)[/tex]

[tex]y =-\frac{1}{2}(x +2)(x - 3)[/tex]

Answer:

C

Step-by-step explanation:

what is a kite? what are its properties? what is its use in our daily life?

Answers

Answer:

Well, in geometry, the properties would be that the angles produced by the intersection of the diagonals are right angles. A kite is basically entertainment, made by cloth and string

A kite is a four sided shape. Like an elongated rectangle.a kite is a quadrilateral whose four sides can be grouped into two pairs of equal-length sides that are adjacent to each other. In contrast, a parallelogram also has two pairs of equal-length sides, but they are opposite to each other instead of being adjacent. Kite quadrilaterals are named for the wind-blown, flying kites, which often have this shape and which are in turn named for a bird. Kites are also known as deltoids, but the word "deltoid" may also refer to a deltoid curve, an unrelated geometric object.Kites have been used for human flight, military applications, science and meteorology, photography, lifting radio antennas, generating power, aerodynamics experiments, and much more.

The quantity five times a number y decreased by twelve. Group of answer choices 5y - 12 12 - 5y 12y - 5 12 + 5y

Answers

Answer:12 - 5y

Step-by-step explanation:

The quantity five times a number y decreased by twelve means that  5 multiplied by a number is subtracted from 12, it also means that 12 minus 5 times a number y and can be written mathematically as

12 - 5y

PLEASE HELPPPPPP FINDING CIRCUMFERENCE AND AREA OF A CIRCLE

Answers

Answer:

The circumference of the circle is 28.26 m.

The area of the circle is 63.585 [tex]m^{2}[/tex].

Step-by-step explanation:

To solve for the circumference of the circle, start by using the circumference formula of a circle, which is [tex]C= 2\pi r[/tex]. However, 3.14 will be used instead of [tex](\pi)[/tex] for this formula.

First, the radius of the circle needs to be found. To find the radius of the circle, divide the diameter by 2 because the radius equals half of the diameter. The radius is 9 m divided by 2, which equals 4.5 m.

Next, plug in the radius into the formula, and the formula will look like [tex]C=(2)(\pi )(4.5 m)[/tex]. Then, solve the equation, and the answer will be 28.26 m.

To solve for the area of the circle, start by using the area formula of a circle, which is [tex]A=\pi r^{2}[/tex]. However, 3.14 will be used instead of [tex](\pi)[/tex] for this formula.

For the area, plug the radius into the formula, and the formula will look like [tex]A= (3.14)(4.5m)^{2}[/tex]. Then, solve the equation, and the answer will be 63.585 [tex]m^{2}[/tex].

Other Questions
Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area.