Study the energy pyramid.

In this pyramid, what level is the frog?

Answers

Answer 1

Answer:

Tertiary consumers i think


Related Questions

hy please make some questions from this passage please i want to ask my students thank you​

Answers

Explanation:

1) Write the balanced chemical equation of photosynthesis.

2) What is the role of chlorophyll in the process of photosynthesis?

3) What happens to the light energy that is absorbed by the chlorophyll?

Hello who’s good at biology guys I need someone to help me with the test

Answers

I Dont Even Know If Am Good In Biology Or Not

But Some Chums Might Give You A Hand

why is night blindness regarded as a non infectious disease​

Answers

Answer:

Explanation:

stay away from the dark frfr sh1 creepy dog

How to Define life ?​

Answers

The condition that distinguishes animals and plants from inorganic matter, including the capacity for growth, reproduction, functional activity, and continual change preceding death.

This is the definition of life.

Answer:

Life is defined as any system capable of performing functions such as eating, metabolizing, excreting, breathing, moving, growing, reproducing, and responding to external stimuli.


2. A hormone that is produced by the endocrine system targets specific
cells ir many different parts of the body. Which of the following
mechanisms explains the best way for the hormone to efficiently reach all
of its target cells?

The hormone is released into the bloodstream where it can be carried throughout the
body to the target cells with specific receptors

The hormone reacts with neurons close by that signal the target cells throughout the
body

The hormone is transported by local regulation to cells close by that trigger the target
cells

The hormones moves throughout all the cells until it reaches the cells with the
specific receptors for the signal

Hurry please I’m taking a exam

Answers

Answer:

The correct answer is the first option:-

The hormone is released into the bloodstream where it can be carried throughout the  body to the target cells with specific receptors.

I learnt in biology that hormones are transported through blood so they reach the specific receptors and act upon them so am sure this is the answer!.

The other options aren't right for the question.

the measurement of the matter in the universe is called

Answers

Answer: mass

Explanation:

How much has the greenhouse gas carbon dioxide increased in the air just in the last few years? ITS DUE IN A FEW HOURS PLEASE HELP!

Answers

Answer:

approximately 2.3 parts per million (ppm) per year

Explanation:

In 2019, the global amount of atmospheric carbon dioxide (CO2) has been estimated at approximately 410 parts per million (ppm). These levels are higher than at any time in the last 800,000 years, and it has been estimated that in 2025 the CO2 levels will be higher than at any time in the last 3.3 million years. In 2018, there has been an increase of approx. 2.5 ppm, the same increase observed between 2017 and 2018. Moreover, the average increase of the CO2 levels in the atmosphere between 2009 and 2018 was 2.3 ppm each year.

Which statement describes earthquakes which team explain one way that minerals form

Answers

Earthquakes are natural phenomena characterized by the sudden release of energy in the Earth's crust, resulting in seismic waves that can cause the ground to shake.

During an earthquake, the rocks along the fault experience immense pressure and deformation.

This intense pressure can cause minerals within the rocks to undergo various processes that contribute to their formation.

One way minerals can form as a result of earthquakes is through metamorphism.

Metamorphism is the process by which existing minerals within rocks undergo changes in response to high temperatures, pressures, and deformation.

During an earthquake, the rocks near the fault zone are subjected to extreme pressure and temperature conditions.

The intense stress causes the minerals to recrystallize, rearrange their atomic structures, and form new minerals.

This process is known as dynamic metamorphism or cataclasis.

The newly formed minerals in fault zones can include varieties of quartz, feldspar, mica, and other minerals commonly found in metamorphic rocks.

The specific minerals that form depend on the composition of the original rocks and the conditions present during the earthquake.

For more questions on Earthquakes

https://brainly.com/question/20409140

#SPJ8

Which of the following is a density-dependent factor?
(a)habitat size
(b)volcanic eruptions
(c)cold weather
(d)food availability

Answers

Answer:

A

Explanation:

Answer: (D) food availability

Explanation: its the only one that is density dependent, all the others are density independent.

Water is carried from the roots upward to every part of a vascular plant by
cells walls.
O cuticle.
phloem.
xylem
Use the concept map below to answer the following question.

Answers

The answer is cell walls

Suppose an explorer discovered a unique new species of plant and collected a sample for analysis by a geneticist. The geneticist then isolated chromatin from the plant sample and examined the chromatin using electron microscopy. The chromatin observed was organized in a way that is similar to beads on a string A small amount of nuclease was then added, which was observed to cleave the string into individual beads that each contained 280 bp of DNA.
Histone H1 H2A H2B H3 H4 H7 (new histone)
Percentage 12.5% 25% 25% 0% 26%
After thorough digestion with more nuclease, only a 120 bp fragment of DNA remained attached to a core of histone eins. Analysis of the histone core revealed the data dicated in the table to the right.
Using the data provided, determine the conclusions that the geneticist could make about the likely structure of the nucleosome in the chromatin of this new plant species
A. The nucleosome core contains a heterodimer of the histones H7 and H1
B. The nucleosome core contains two each of histones H2A, H2B, and H4
C. The nucleosome core contains a homodimer of the histones H2A, H2B, and H4
D. The nucleosome core contains one each of histones H1 and H7
E. The nucleosome core histone H7 replaces the standard histone H3

Answers

my brain can't process this lol

state how the protein and energy requirements of the following will differ from those of a 16 year old female who does not take much exercise (1) An elderly person (2) a 2 year old child (3) a pregnant women (4) a male athlete​

Answers

Answer:

Elderly people need a lot of protein but less energy and a pregnant woman need both nutrition enough to cell function and tissue formation of the embryo and more equal does the the 2 year old baby need both the nutrition.

____________ are made of a series of paired statements that describe physical characteristics of different organisms.

Answers

Answer:

taxonomic key

this is A series of paired statements that describe the physical characteristics of differnent organisms.

Answer:

taxonomic key

Explanation:

A series of paired statements that describe the physical characteristics of differnent organisms.

Are the energy resources used at school renewable or nonrenewable

Answers

Answer:

Resources are characterized as renewable or nonrenewable; a renewable resource can replenish itself at the rate it is used, while a nonrenewable resource has a limited supply. Renewable resources include timber, wind, and solar while nonrenewable resources include coal and natural gas.

Explanation:

What is the term used for genetic mutations that may result in neutral or even negative outcomes?(1 point)

A) genetic drift

B) natural selection

C) artificial selection

D) genetic modification

Answers

Answer:

Genetic Drift

Explanation:

Evolutionary change can and does occur without natural selection. This usually occurs as a result of genetic drift: genetic mutations that may result in neutral or even negative outcomes.

The term 'GENETIC DRIFT' is used for genetic mutations that may result in neutral or even negative outcomes (Option A).

Genetic drift refers to random fluctuations in the frequency of a given gene variant (i.e. an allele) and different genes in the individuals that form a population.

Genetic drift may occur on neutral or negative alleles carried out by the individuals of a population.

These random fluctuations cause changes in the allele frequencies, which are fixed when they reach a frequency equal to one (1).

In conclusion, the term 'GENETIC DRIFT' is used for genetic mutations that may result in neutral or even negative outcomes (Option A).

Learn more in:

https://brainly.com/question/12985618

A. The capture/mark recapture method was used to give an accurate
estimate of the rhinoceros beetle population in the Western province. Traps
were set up and captured beetles were painted light brown as oppose to red an
yellow. All captured-recaptured were counted and recorded.
Total count
in
Total marked
Total counts
in
Total marked
40
40
15
35
Use the Lincoln Index to calculate the total beetle population?​

Answers

Do not click in the link above above , he is a scammer and trying to fool us. Report any accounts you see saying that and using that link.

Question 10 of 10
Why do fungi need to live in moist areas?
A. Their large surface areas make them dry out easily.
B. They can only reproduce sexually.
C. They are unable to photosynthesize.
D. Their filaments make it difficult to absorb nutrients.

Answers

Answer:

A. Their large surface areas make them dry out easily.

Explanation:

(A.P.E.X)

In the year 2000, more than 225 million acres of forests were burned throughout the
world. A forest fire can have a dramatic effect on the plants and animals that live in a
forest.
• Describe one negative and one positive effect of a forest fire.
One way of controlling how severe a forest fire becomes is to deliberately set small
fires in what is known as a "controlled burn."
• Describe two ways that a controlled burn can benefit a forest.
Name the type of ecological succession that would occur after after a forest fire.

Answers

Answer:

In 1960, the U.S. Forest Service started keeping detailed records of damage caused by wildfires. ... Between 2000 and 2013, nearly 161 million acres were consumed by wildfires -- more in 13 years than in the previous 40 years, combined. ... they would have been had fuel sources been able to burn off naturally over time.

Missing: 225 ‎| Must include: 225

Explanation:

4. How does a sound wave vibrate?

Answers

When sound waves move through the air, each air molecule vibrates back and forth, hitting the air molecule next to it, which then also vibrates back and forth. The individual air molecules do not "travel" with the wave. They just vibrate back and forth.

You want to determine if the source of fecal contamination is from dairy cows or wild deer. Which antibiotic would give you the most clear results and why

Answers

Answer:

Piperacillin and tazobactam, imipenem and cilastatin, or meropenem may be used.

Explanation:

Antibiotics such as piperacillin and tazobactam, imipenem and cilastatin, or meropenem can be used for the treatment of Fecal coliform bacteria that causes fecal contamination. There are some other methods also used to avoid Fecal contamination i.e. boiling of water, treating water with chlorine, or UV disinfection are the methods that are used to reduce Fecal coliform bacterial infection.

I need help please help

Answers

Answer:

its d cause

Explanation:

Correlative Conjunctions are pairs of words used to connect two parts of a sentence with equal value.

3. When the mRNA is translated, the order of its codons determines the order of amino acids in the resulting polypeptide O a. True O b. False​

Answers

Answer:

True

Explanation:

How did a famous event change the course of the American Revolutionary War? in essay form pls

Answers

Answer:

The American Revolution was a political battle that took place between 1765 and 1783 during which colonists in the Thirteen American Colonies rejected the British monarchy and aristocracy, overthrew the authority of Great Britain, and founded the United States of America. See the fact file below for more information and American Revolution facts.

-The American Revolution, also known as the Revolutionary War, began in 1775.

-British soldiers and American patriots started the war with battles at Lexington and Concord, Massachusetts.Colonists in America wanted independence from England.

-The British government attempted to pass some laws, enforce several taxes, and increase more control over the colonies.

-The colonies strongly objected to these laws and taxes.

-They wanted England to have no control over them.

-For ten years before the war actually started, there was a lot of tension between England and the colonies.

-The colonies had no central government at the beginning of the war, so delegates from all the colonies were sent to form the first Continental Congress.

-George Washington, a former military officer and wealthy Virginian, was appointed Commander in Chief of the Continental Army.

-Members of the Continental Congress wrote a letter to King George of England outlining their complaints and declaring their independence from England.

-On July 4, 1776, the Continental Congress adopted the Declaration of Independence, in which the colonies declared their independence from England.

-The war ended in 1783, and the United States of America was born.

Explanation:

Which of the following are not found in Cyanobacteria?

Answers

Answer:

Like all other prokaryotes, cyanobacteria lack a membrane-bound nucleus, mitochondria, Golgi apparatus, chloroplasts, and endoplasmic reticulum. All of the functions carried out in eukaryotes by these membrane-bound organelles are carried out in prokaryotes by the bacterial cell membrane.

According to the passage, which of the following topics of study was the most crucial to his final analysis?
The study of statistics and probabilities

The study of plant varieties

The study of agriculture

His study of the experimental method

Answers

Answer: The study of plant varieties.

Explanation:

This question relates to the studies that Gregor Mendel, founder of modern genetics, performed at the University of Vienna.

Experimenting on pea plants, Gregor Mendel was able to establish a lot of the rules of heredity that we know today even though his research was not fully appreciated or understood during his own life.

He credited the study of plant varieties to have been most crucial to his final analysis because farmers had been crossbreeding varieties for millennia to bring about better traits in plants.

Mutations that change the bases in a base pair are ____________.

Answers

Answer:

A point mutation is when a single base pair is altered. Point mutations can have one of three effects. First, the base substitution can be a silent mutation where the altered codon corresponds to the same amino acid.

Explanation:

mark brainliest

2. Which part of a eukaryotic cell contains the instructions on how to recombine the molecules in nutrients into new molecules that the cell can use?

A. DNA in the nucleus
B. Chlorophyll in chloroplasts
C. Water in vacuoles
D. Digestive chemicals in lysosomes

Answers

A. DNA in the nucleus.
Our nucleus in each cell encodes messages for other organelles to acquire. The organelles use these messages to sustain everyday activities.
Chloroplasts function to convert solar energy into energy the cell can use in a plant cell.
Vacuoles store water, molecules, waste and other substances.

diarrhoea definition​

Answers

Answer:

A condition in which feces are discharged from the bowels frequently and in a liquid form.

Explanation:

Hope this helps and have a wonderful day!!!

Which animal in a pond food chain would be on the same trophic level as a snake in a grassland ecosystem?
(A) Algae
(B) mosquito larva
(C) fish
(D) racoon

Answers

I think a raccoon because both are predators

In a pond food chain ecosystem, a fish feed on mosquito, a producer. The fish may get eaten by a racoon, which in turn is consumed by a snake. In a pond, algae is autotroph. So the correct option is D (racoon).

What is trophic level in ecosystem?

Trophic level is defined as the ranking of an organism in the food chain and which differ from a value of 1 for primary producers to 5 for marine  humans or mammals.

Racoon is mammal and omnivorous whereas the snake is carnivorous animal.  In a pond ecosystems, the biomass pyramid is inverted.

For more details regarding pond ecosystem visit:

https://brainly.com/question/24312891

#SPJ2

PLZ HELLLP TONS OF POINTS (this is on a FINAL)
two students are comparing scientific experiments to investigations. They came up with the following ideas.

Student A: Testing plant growth in different types of soils
Student B: Comparing the water level in a lake during different times of the year

Which student gave an example of a scientific experiment?

Student A because it requires experimental and control groups
Student B because it requires a hypothesis
Student A because it is preferably done in natural settings
Student B because it is preferably done across a long period of time

Answers

Answer:A

Explanation:

Other Questions
Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid) 8. (5 pts) what is (0.00034) x 48579? make sure the reported answers is rounded properly. a) 16.5 b) 17 c) 16.517 d) 16.52 : In its 2019 annual report, Whirlpool Corporation reported that it had revenues of RM18.1 billion, cost of goods sold of RM15.2 billion, accounts receivable of RM2 billion, inventory of RM2.4 billion, and account payable of RM3.71 billion. (a) Calculate cash conversion cycle Whirlpool Corporation (assuming a 365-day year). (6 marks) (b) Draw a timeline for Whirlpool's operating cycle and cash conversion cycle. your home insurance provides for replacement value for personal property losses. a microwave is stolen. it cost $270 two years ago and has an expected life of six years. a comparable microwave costs $385 today. what amount will the insurance company pay?