PLEASE please help me! this is due tonight. thank you

explaining your answer = brainliest/ five stars

the perimeter of this square is 48 cm. c = ___ cm

PLEASE Please Help Me! This Is Due Tonight. Thank Youexplaining Your Answer = Brainliest/ Five Starsthe

Answers

Answer 1

Answer:

c = 12

Step-by-step explanation:

If c is one side you would need to multiply that side times 4 because that's the way you find the perimeter. In this case, you need to divide 48 by 4 so that you get the centimeters for each side. The answer is 12

Brainliest pls


Related Questions

a container of water is filled to 1/3 of it. if we add 2.5 liters the container will be half full. find how much is the volume of the container. convert it to cm³​

Answers

Answer:

In picture

Step-by-step explanation:

Brainliest please

Please help me with this one …..

Answers

Answer:

is the clean area the desired one (I assume, yes)?

then y <= 3x + 5

if the dotted area is the desired area, then

y >= 3x + 5

Step-by-step explanation:

the factor of x is the slope of the line expressed as y/x ratio.

clearly, the line shows that for x changing by 1 unit y changes by 3 units. so, the slope is 3/1.

that leaves us only with the 2 middle options.

for "y <=" the desired values of y for a given x must be on the line (equal) or below (smaller than the value of the line equation). that is true, if the desired area is the clear one (no dots).

so, "y >=" is true, if the dotted area is desired.

Find the value of x.

Answers

Answer:

Step-by-step explanation:

When two chords intersect inside the circle, the product of their segments are equal.

BE * ED = AE * EC

x *3x = 4 *3

3x²   = 12 {Divide both sides by 3}

  x² = 12/3

  x² = 4

  x = √4

  x = 2

Answer:

The value of x is 2.

Step-by-step explanation:

We know that , when the two chords are intersect inside the circle, the product of their segment are equal.

So, BE × ED = AE × EC

putting the values

x × 3x = 4 × 3

multiply the values

3 x ² = 12

divide 12 by 3

x ² = 12 / 3

x ² = 4

Taking the square root of 4

x = √4

x = 2

The value of x is 2.

what is
- l4l equal to?

Answers

Answer: -4

Explanation:

Absolute value is the distance that a number is away from zero. Keep in mind that the absolute value is always positive.

However since the negative sign is on the outside of the function , you leave it on the final answer. Therefore the answer is -4

I need help ASAP!! Please.

Answers

Answer:

x = 8

Step-by-step explanation:

A system of equations consisting of a circle and a line is graphed. Which statements about the number of possible solutions are correct? Check all that apply.
A circle and a line always intersect, so the system can have an infinite number of solutions.
A circle and a line can intersect at one point, so the system can have one solution.
A circle and a line can intersect at three points, so the system can have three solutions.
A circle and a line can intersect twice, so the system can have two solutions.
A circle and a line do not have to intersect, so the system can have no solution.

Answers

Answer:

the solution is where the two objects intersect ...

1) A line can completely miss the circle (no solutions is possible)

2) a line can "kiss" the circle at one point (one solution)

3) note that a line can not "bend"... it can touch one side of the circle pass

through the center and touch the circle in a second spot (going out) .. two solutions...

those are the three possibility that are in the question that was posted...

three check comments are true

Step-by-step explanation:

PLEASE ANSWER THIS QUESTION IM BEGGING YOU !

Answers

6% chance of pulling blue and then yellow

Answer:

5/36

Step-by-step explanation:

There are 12 tiles

P( blue) = blue /total = 5/12

We put the first tile back so there are still 12 tiles in the bag

P(yellow) = yellow/total = 4/12 = 1/3

P( blue, yellow) = 5/12 * 1/3 = 5/36

Ben is monitoring a colony of bacteria. Initially, the colony consists of 159 bacteria. The following function represents the number of bacteria in the colony after x hours.



Which expression approximately represents the number of hours, x, it takes for the number of bacteria in the colony to reach 168?

Answers

Answer:

No solution is possible from the information provided

Step-by-step explanation:

you didn't include the function.

Một xí nghiệp sản xuất độc quyền hai loại sản phẩm. Biết hàm cầu của hai loại sản phẩm trên lần lượt là 1 2 Q 40 2 ; Q 35 D D 1 2 1 2       P P P P và hàm chi phí kết hợp là 2 2 1 1 2 2 1 2 C Q 6Q Q +Q +15Q 150 .    Q Trong đó, P,Q 1,2   i i i  lần lượt là đơn giá và sản lượng của sản phẩm thứ i . a) (CLO1.3, CLO2.2, CLO4.2) Tìm mức sản lượng của mỗi loại sản phẩm để xí nghiệp có lợi nhuận tối đa. Khi đó, giá bán các sản phẩm là bao nhiêu? b) (CLO1.3, CLO2.2, CLO4.2) Tính chi phí cận biên cho từng loại sản phẩm tại mức tối ưu tìm được ở câu a).

Answers

ah, i’ve seen this one before. this answer is no no idea why you gotta get a chance and i’m you to go pick it out to get your stuff back on your car wash the car and stuff and you get your hair and get it done and you get a little more comfortable with your car and you get a hold on you like that one or a little bit more and stuff and like move you

The Mariana trench, off the coast of Guam in
the Pacific Ocean, is 11 034m deep. Write 11
034 in standard form.​

Answers

Answer:

11,000 + 30+4

Step-by-step explanation:

What is the length of leg s in the right triangle shown?

Answers

Answer:

D. 5

Step-by-step explanation:

Applying,

cos∅ = adjacent/Hypotenuse

From the diagram,

Given: ∅ = 45°, adjacent = s, hyptenuse = 5√2

Therefore,

cos45° = s/5√2

make s the subject of the equation

s = cos45°×5√2

s = (1/√2)(5√2)

s = 5

Hence the right answer is D. 5

Check out this square pyramid: Find the surface area of the square pyramid (above) using its net (below).

Answers

Answer:

12 square units

Step-by-step explanation:

Given

See attachment for net

Required

The surface area

The net has the following shapes:

1 Square: (Length =2)4 congruent triangles (Base = 2; Height = 2)

So, the surface area is:

Area = Area of Square + 4 * Area of 1 Triangle

[tex]Area = 2 * 2 + 4 * \frac{1}{2} * 2 * 2[/tex]

[tex]Area = 4 + 8[/tex]

[tex]Area = 12[/tex]

What is the product?

Answers

Answer:

Step-by-step explanation:

You can do this in two steps.

4s * (5s^2 + 10s + 3)                   Remove the brackets

20s^3 + 40s^2 + 12 s

2(5s^2 + 10s + 3)  

10s^2 + 20s + 6

Now add them

20s^3 + 40s^2 + 12s + 10s^2 + 20s + 6

Rearrange them so the like terms are together.

20s^3 + 40s^2 + 10s^2 +12s + 20s + 6

20s^3 + 50s^2 + 32s + 6

If the graphs of the linear equations in a system are the same line, what does that mean about the possible solution or solutions of the system? А.) There is exactly one solution
B.) There is no solution.
C.) There are infiriitely many solutions
D.) The lines in a system cannot graph the same line.
((PLEASE HELPPP))​

Answers

I think it’s c there are many solutions

Which inverse of the difference of 1/3 - 1/4?

Answers

Answer:

0/1

Step-by-step explanation:

find x if the mean of the number is 13 ,2x,0,5x,11 and 9

Answers

Answer:

45/7

Step-by-step explanation:

ok lets first find the total sum. there are 5 numbers so 13*5=65

2x+0+5x+11+9=65

7x=45

x=45/7 or 6.42857143

If polygon ABCD rotates 70° counterclockwise about point E to give polygon A'B'C'D', which relationship must be true? A. BB' = DD' B. m∠ABC < m∠A'B'C' C. m∠ABC > m∠A'B'C' D. A'E' = AE

Answers

Answer:

A'E' = AE

Step-by-step explanation:

Transformation is the movement of a point from its initial position to a new position. Types of transformation are rotation, reflection, translation and dilation. If an object is transformed then all its points are also transformed.

Rigid transformations are transformations that preserves the shape an size of an object (i.e. the side length and angles). Examples of rigid transformations are rotation, translation and reflection.

Since rotation is a rigid transformation, the side lengths and angles of polygon A'B'C'D' would be the same as that of polygon ABCD. Therefore:

A'E' = AE

Can someone help me?​

Answers

Answer:1565

Step-by-step explanation:

tehret

7 √x +4 Is it a polynomial?​

Answers

Answer:

Phải

Step-by-step explanation:

Write the equation of the line in slope-intercept form

Answers

Answer:

y=-1x-4

hope you have a great day

Un arco de 50 m de longitud subtiende un ángulo central θ en un círculo de 35 m de radio. Encuentre la medida de θ.

Answers

Answer:

θ = 81.89°

Step-by-step explanation:

Si tenemos un círculo de radio R, el perímetro de este círculo estará dado por:

P = 2*pi*R

donde pi = 3.14

Ahora, si en lugar de el círculo completo solo queremos la longitud de un dado arco, definido por un ángulo θ, el largo de ese arco estará dado por:

L = (θ/360°)*2*pi*R

Notar que cuando θ = 360° (es decir, el ángulo del círculo completo) el largo del arco será igual que el perímetro, lo cual deberíamos esperar.

Ahora sabemos que:

El arco tiene 50m de longitud.

El radio del círculo es 35m

queremos encontrar el valor de θ

Reemplazando esos valores en la ecuación de arriba obtenemos:

50m = (θ/360°)*2*3.14*35m

Ahora solo debemos resolver esto para θ

50m = (θ/360°)*219.8m

(50m/219.8m) = (θ/360°)

(50m/219.8m)*360° = θ = 81.89°

Help please! I really need it

Answers

I think it’s none of those.
Radius is a line that reaches the middle of the circle, so like
——
CA

What are the real roots of the function in the graph?

Answers

Answer:

-1 and 3

Step-by-step explanation:

The real roots of a function are located where the function passes through the x-axis. In this case, the function passes through x=-1 and x=3, making them the real roots of the function.


Which are the solutions of x2 = -13x – 4?

Answers

Answer:

x=3.75

Step-by-step explanation:

PLEASE HELP ME WITH THIS

Answers

-3 is the 3rd box and you go down 3 spaces then over 2

Help please!!!!help help help

Answers

Answer:

ask the goggle not 1 you help in thi aap bro your aand me same thing make sorry

Answer:

{-2,-1, 0, 1, 8}

Step-by-step explanation:

Domain is the input values ie. x values

{-2,-1, 0, 1, 8}

What is the explicit formula for this arithmetic sequence?
-12,-17, -22, -27, ...

Answers

Answer:

Step-by-step explanation:

An explicit arithmetic formula in standard form is

[tex]A_n=a_1+d(n-1)[/tex] where n is the position of a number in thesequence, a1 is the first number in the given sequence, and d is the common difference. The common diff here is -5 since we have to subtract 5 from each term to get to the next one in the sequence. The first number is -12. So

a1 = -12

d = -5 and the explicit formula is

[tex]A_n=-12-5(n-1)[/tex] and you could simplify it a bit to

[tex]A_n=-12-5n+5[/tex] and finally to

[tex]A_n=-5n-7[/tex] which is a linear representation. Arithmetic sequences can all be simplified down to represent lines.

A sphere with a radius of 11 Ft so what is its volume FASTTT PLSSSSS

Answers

Step-by-step explanation:

volume of the sphere=4/3×π×r³

=4/3×3.14×11³

=5572.4533ft³

If f left parenthesis x right parenthesis equals x squared minus 3 x plus 5 , then f left parenthesis 4 right parenthesis equals

Answers

Answer:

f(4) = 9

Step-by-step explanation:

f left parenthesis x right parenthesis equals x squared minus 3 x plus 5

f(x) = x² - 3x + 5

f left parenthesis 4 right parenthesis equals

f(4) =

f(x) = x² - 3x + 5

When x = 4

f(4) = 4² - 3(4) + 5

= 16 - 12 + 5

= 9

f(4) = 9

Answer:

Pretty sure its A

Step-by-step explanation:

Which expression is equivalent to the following fraction?

Answers

Given:

The fraction is:

[tex]\dfrac{\dfrac{-2}{x}+\dfrac{5}{y}}{\dfrac{3}{y}-\dfrac{2}{x}}[/tex]

To find:

The expression that is equivalent to the given fraction.

Solution:

We have,

[tex]\dfrac{\dfrac{-2}{x}+\dfrac{5}{y}}{\dfrac{3}{y}-\dfrac{2}{x}}[/tex]

After taking LCM, we get

[tex]\dfrac{\dfrac{-2y+5x}{xy}}{\dfrac{3x-2y}{xy}}[/tex]

[tex]\dfrac{-2y+5x}{3x-2y}[/tex]

Therefore, the correct option is A.

Other Questions
Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area. what is the range of 20,15,10,5 Find the approximate surface-area-to-volume ratio of a bowling ball with a radius of 5 inches.A 0.6B. 0.67C. 1.67D. 25 A bakery celebrated its 25th anniversarylast Friday. On that day, every 12thcustomer received a free loaf of breadand every 9th customer received a freecupcake.Lauren was the first customer to receivea free loaf of bread and a free cupcake. What was Lauren's number?