Please help!!


Either the gallery director or the artists (is, are) at the center of that crowd.

Answers

Answer 1

Answer:

Either the gallery director or the artists are at the center of that crowd.


Related Questions

This is about Serving in Florida, PART A is speaking about how the interview is onerous
PART B: Which of the following details from the text best supports the answer to Part A?
A. "a twenty-minute interview' by computer since, apparently, no human on the premises is deemed capable of representing the corporate
point of view."(Paragraph 5)
B. "a large room decorated with posters illustrating how to look 'professional'., and warning of the slick promises that union organizers might
try to tempt me with."(Paragraph 5)
C. "How many dollars' worth of stolen goods have I purchased in the last year? Would II caught him stealing?"
(Paragraph 5)
D. "Apparently I ace the interview, because I am told that all I have to do is show up in some doctor's office tomorrow for a urine test."
(Paragraph 6)

Answers

Answer:

B

Explanation:

its b

pls help its due like rn

Original Quote:
Taken an hour or so before exercise, [caffeine] also enables most athletes to run, bike, swim, or otherwise perform a little faster or more vigorously than if they do not have caffeine first.

Gretchen Reynolds of The New York Times notes that having caffeine before a workout allows most athletes to perform a little faster or more vigorously than if they do not have caffeine first.


is it A strong paraphrase or Plagiarism?

Answers

Answer:

Yes cause you cited it in your own words

Explanation:

Cuz it’s cited in the words

Note to everyone

Thankyou to everybody that followed me and helped me with my work i reaally appreciate it, i just wish i can give everyone how many points they want.
Im really happy for myself and the new people to this app.

Goal* Get More followers
Goal 2* Be happy
Goal 3* Get brainlist

I love you guys and ty

Answers

this is really sweet of you

Conduct some research on the Internet about a current major story in the news. It can be international or national news. Find two different news sources that are telling this same story. Find one from a U.S. source, and then find a non-U.S. news source (ideally a non-Western source altogether). First, summarize the story and identify what two news sources you used. Discuss the similarities and differences of how the stories were told. Consider any bias that either of the news sources may have, and explain how those biases may affect the telling of the story.

Hint: When trying to find the bias of a news source, consider any motivations that the news leadership may have for telling a story in a particular way. Historical? Political? Financial?

Answers

Answer:

Every day for four years, I would drive to my job, and every day at the same time, on the same route, I would notice the city bus. It would pull up next to me, and I would see all the people on board. Some would be reading. Some would be sleeping. Some would stare back at me. Every day, at the same time, it would follow me right to work. As I pulled into my parking space at work, I would see it around the corner, about a block away from my job. Then, one day, my car broke down. I had no way to get to work, and then, I remembered the bus. I decided to take it since I knew it was on the same schedule as I was. Since then, I have never driven to work again. Taking the bus is a useful method with which to travel because you can save a lot of money by using public transportation. One reason public transportation is useful is because it saves money. My commute to work was long, and it required a lot of gas. When I drove to work, I was spending $30 a week on gas. There are 52 weeks in a year. That translates to $1,560.00 a year I was spending on gas to get to work. When I started taking the bus, it cost $2 ($1 to get to work and another $1 to get home). Another way to save money is to use the toll road. That translates to $10 a week. That means that it cost me $520 a year to get to work. That's less than a third of what it cost to drive. It saved me $1,040.00. The funny part is that the reason my car broke down in the first place was because I was driving it constantly. 6 What is the central idea of this passage?

Answer:

CNN reported on the conflict in Gaza, providing a summary of the events and the reasons behind the escalation. They focused on the rocket attacks from Gaza and the Israeli airstrikes in response. CNN included quotes from Israeli officials and mentioned the civilian casualties on both sides. Their report was relatively balanced, presenting perspectives from both Israelis and Palestinians.

On the other hand, Al Jazeera covered the same story but with a different emphasis. They highlighted the historical context of the conflict, going back to the Israeli occupation and the displacement of Palestinians. They provided extensive coverage of the Palestinian casualties and criticized Israel's actions. Al Jazeera's report had a clear pro-Palestinian bias, with fewer quotes or perspectives from Israeli officials.

The bias of each news source can be attributed to several factors. In the case of CNN, potential motivations for bias could include the desire to maintain a neutral stance, cater to their predominantly American audience, and adhere to journalistic standards of objectivity. As for Al Jazeera, their bias may stem from their Qatari ownership and their aim to represent the perspectives of the Arab world.

It's important to recognize that all news sources may have some level of bias, whether intentional or unintentional. In this case, the biases of CNN and Al Jazeera affected how the story was presented. CNN aimed for a more balanced approach, while Al Jazeera prioritized highlighting the Palestinian perspective and grievances.

Overall, by comparing the reporting from CNN and Al Jazeera on the conflict in Gaza, we can observe the differences in emphasis, perspective, and bias between U.S. and non-U.S. news sources. It's crucial for readers to consume news from multiple sources to gain a more comprehensive understanding of complex global events.

Explanation:

Trust me and mark this answer brainliest!

CAN SOMEWON PLS HELP?!

Answers

what would you like help with??

What is the correct form for a safe and successful handstand?





P.E

Answers

look up a video or something
To balance and try not to fall

Why does Rachel say, “only it's too late” after describing her birthday party?

Answers

Answer:

ok so basically the story is eleven. The story is about this girl names Racheal and she doesn't like to stay at the age of eleven. There was a problem with the sweater at school. She got bullied.

Explanation: Now I don't know exactly the answer to this question is because I don't remember this part I'll look forward to this question and try to help the best I can!

HELP PLEASEEEEEEEE thank you

Answers

Answer:

i can answer but i dont see anything

Explanation:

Answer:

The answer should be C

Explanation:

Consider the factors that would influence settlement

Answers

I’m sorry what exactly is the question you need help with? If you right the question more clearly I can try to help you. Have a nice day!

i need help with all ASAP if correct i will give u brainlist here are some the other 2 are next

Answers

The answers are;
A. Hit the nail on the head
C. Wants Jamal to calm down...
D. Was under the weather
B. She will look everywhere until she finds her monkey
The answer for the first question is

D. Was under the weather

The second answer for the next page is

C. It costs a lot of money

The answer for the third page is

B. She will look everywhere for her monkey

The answer for the fourth page is

A. Hit the nail on the head

And the last page answer is

C. Jamal wants him to calm down and get in control


Trust me I am right! Good luck

QUICKLY!!! TEN POINTS!! BRAINLIEST FOR WHOEVER GETS IT RIGHT!!

Which statement best describes the author's argument
in this part of the article?
Read the excerpt from "Healthy Eating."

Unless you're trying to lose weight, nutritionists like to
avoid diets.

"We were just laughing about that, like we could sell fairy
dust and that's pretty much what a lot of these fad diets
are about," said Natalie Castro-Romero, the corporate
dietician at Baptist who oversees the company's 15,000
employees.

"One very common thing that happens is people feel
overwhelmed and they need a starter to get something
going, like a detox, but there's no truth behind that."

For some people, small changes can lead to big results.



Diet plans are helpful only for people who want to
make a change.

People should not feel pressured to start living a
healthier lifestyle.

People do not need to take drastic measures to start
eating healthier.

Diet plans cause much more harm than people think
they do.

Answers

Answer:

In the given excerpt from "Healthy Eating", the statement that reflects the author's argument the best is that 'A busy lifestyle often gets in the way of healthy eating habits' with an intended to message to aware the audience regarding their busy lifestyle and suggest them to be more concerned about their eating. Hope this helps

Explanation:

Answer:

C) people do not need to take drastic measures to start eating healthier

Explanation:

The passage talks about how diets are not actually the best way to go. At the end, the author says "for some people, small changes can lead to big results." This leads me to believe that the answer is C because you can see results without drastic measures like crazy diets. Hope this helped!!

Choose the two things that are being compared.

"My leg hurts like a broken stick."

A. broken

B. stick

C. leg

Answers

Answer: b and c youir welcome brainlieedsr4 me?]

Explanation:

Answer:

C) legs

B) stick

Explanation:

my legs hurt like a broken stick

it's comparing his legs being broken like a stick

hope it helps u ^-^

How do the remarks from Walter Morris, Roger Walden, and Clarence Beavers exemplify the sentiments in the final paragraphs of Elie Wiesel’s speech? Answer in two strong paragraphs
(Please help Whom eva answer gets brainiest ngl)

Answers

Answer: he got shot

Explanation:

He is dead

what are key words in this?
What is a thunderstorm? A thunderstorm is a storm that includes lightning and thunder. Some features of thunderstorms are that they produce strong winds, heavy rain and sometimes hail. Thunderstorms are created when moisture collects to form clouds and rain. Unstable air that is warm and can rise rapidly further aids the process. Finally, lift can form from fronts, sea breezes or mountains to make the perfect environment for a thunderstorm.

Answers

Answer:thunderstorm

Explanation:because the question is about it and every thing is written about thunderstorm

Fahrenheit 451 — If you have read this novel please help me fill this out.


Call to Adventure:

Beginning of Journey:

Experience with Unconditional Love:



Answers

Answer:

Call to Adventure: When Montag meets Clarisse. Beginning of Journey: When Montag starts to question society, hide books, etc. Experience with Unconditional Love: Meeting back up with and getting assistance from Faber

Explanation:

Which statement correctly defines a metaphor?

Answers

Answer:

the third one about the switching the truth

Explanation:

Give Me Two Paragraphs of what you know about what happened mid in Hatchet The book ILL Give BRAINLIEST

Answers

Answer

his consciousness, and at this point we do not know to what "The Secret" refers. He suspects it is Jim or Jake, a man in his mid-forties who has been virtually in Hatchet, foreshadowing appears from the first chapters of the book

Explanation:

sorry if it isn't 2 paragraph-

aoxkcksjwkzxksnedisn im trying to unl ock dms akakkwkecucujea

Many companies monitor their employees at work. Companies use technology to do this. Monitoring can help companies. But it can upset workers. What do you think?


Advances in technology have led to an unacceptable loss of individual privacy.

1.Agree
2.Disagree

Explain why you choose your answer the way you did.

Answers

Answer:

I agree. The internet is a dangerous place. People can do very imature and very volgure things on the internet. Hackers can hack into your computer, phone, i-pad and many other devises.

Explanation:

I agree because you never know what people will do these day some people could try to help while other not so much

This is Reading can you help me pls

Answers

Answer:

Metaphor

Explanation:

A metaphor is defined as "a figure of speech in which a word or phrase is applied to an object or action to which it is not literally applicable." This means that saying "She *IS* a typing machine" is a metaphor because it is simply not literally possible. The word "is" will be your hint that a sentence like this is a metaphor and not a simile. A simile usually has the keyword "like" in the sentence (For example: She was *like* a typing machine."

The main difference is that a metaphor claims that two things are the same while a simile claims two things are similar (you can remember this by the "simil" in both of these words!).  

1). Third person Omniscient

2). First person

3). Third person limited

4). Second person

5). Third person objective

Answers

Answer:

might be 2.

Explanation:

:q

Answer:
That’s definitely First person (option 2)

The “middle one”

1). Third person omniscient

2). First person

3). Third person

4). Second person

5). Third person objective

Answers

Answer:

3

Explanation:

Which statement contains personification?
-To which the future is as was the past
-Pillars of the sky at rest
-They have been here now for too long a time
-of their peace

Answers

pilars of the sky at rest

Please help!!!


Neither the patrons nor the artist (has, have) been entirely happy.

Answers

Answer:

have

Explanation:

Answer:

y9gcd er

Explanation:

jshcv jwhdddddddd vw

how the theme is evident in The Lightning Thief

Answers

Answer:

The creator of the Percy Jackson series -- mainly The Lightning Thief knows how the story will head

Explanation:

He most likely does this by Starting from the end and then to the beginning

Friendship is the central them in The Lightning Thief because Percy would have never succeeded in his quest without his friends help

(Hope this helps if not sorry)

The number devil started doing the problem in his head, but his face turned bright red again and swelled up like a balloon. Was it because he was angry, Robert wondered, or because the problem was hard?

“Wait a second,” the number devil mumbled. “I can’t seem to come up with anything. You were right. It doesn’t work. How did you know?”

“I didn’t. You don’t think I’m crazy enough to try a problem like that do you? I was just guessing.”

“Guessing? Guessing is not allowed in Mathematics! Mathematics is an exact science!”

“But when you said that numbers don’t stop, that they go on till the cows come home, that was a guess, wasn’t it?”

“How dare you? What are you, anyway? A beginner! A rank amateur! And you want to teach me my trade?”

—The Number Devil,
Hans Magnus Enzenberger

What is one difference between Robert and the Number Devil that you learn from the passage?

Robert likes to guess, but the number devil does not.
The Number Devil asks questions, but Robert does not.
The Number Devil likes doing math, but Robert does not.

Answers

Answer:

Robert likes to guess, but the number devil does not.

Explanation:

He says that guessing is not allowed so he never does it but robert thinks its ok to geuss when you know the answer.

Answer:

I made this account to give brainliest to person on top :3

Explanation:

⚠️ HELP ASAP! GIVING 25 POINTS⚠️How is tone related to mood?⚠️

Tone and mood are created by the reader's understanding of a text.
Both tone and mood create pictures in a reader's mind.
Both tone and mood rely on the author's choice of words.
The are not related at all because tone is the author's attitude toward the subject.

Answers

Explanation:

tone and mood are created by readers understanding so they are automatically related to each other

Answer:

tone and mood are created by readers understanding so they are automatically related to each other

Explanation:

Why doesn’t raising the minimum age to leave school always lead to higher graduation rates? Cite evidence in the text.

Answers

Answer: hi

Explanation:

HELP
is the word jump and hop would be considered
A. denotations
B. synonyms
C. connotations
D. antonyms

Answers

Answer:

Explanation:

B

Yes the answer B I took the test

Does anyone know the theme from the book Obsessed by Allison Britz??
I really need to know because I'm not the best at language arts.

Answers

Obsessed, is about how a teenager that debilitating struggle with obsessive-compulsive disorder (OCD) When she goes In sophomore year of high school She was a dedicated student with tons of extracurricular activities, friends, and loving parents at home.

But after awakening from a vivid nightmare in which she was diagnosed with brain cancer, she was convinced the dream had been a warning. Allison believed that she must do something to stop the cancer in her dream from becoming a reality.

It’s a memoir about mental illness basically,

Allison’s fascinating memoir goes a long way in educating readers about mental health, OCD, and available mental health resources.

The theme of the book obsessed by Allison Britz is growth and acceptance.

What is obsessed by Allison Britz?

In Obsessed, a teen with obsessive-compulsive disorder (OCD) describes her crippling struggle. She was a committed student in her second year of high school, participating in a ton of extracurricular activities, making friends, and having caring parents at home. The story tells about his life and how he led his life.

She was convinced the dream had been a warning, though, after waking up from a horrific nightmare in which she was told she had brain cancer. Allison was convinced that something needed to be done to prevent cancer from her dream from materializing. It is a memoir about mental illness.

Therefore, growth and acceptance are the main themes in Allison Britz's book, obsessed.

To learn more about theme, refer to the link:

https://brainly.com/question/28364629

#SPJ2

In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow)

Answers

Answer:

no one to hate more than El Patron, who cloned Matt from himself so that he could harvest organs from Matt later in time when El Patron's body fails. Matt is kept against his will, but he doesn't know it, because El Patron makes his life exactly comfortable enough that Matt is perfectly motivated to do what El Patron wants. He doesn't hate El Patron, because El Patron has successful propagandized him, brainwashing him from birth to agree with what he says. Matt must learn to hate his father for his evil in order to be the hero.

Answer:

no one to hate more than El Patron, who cloned Matt from himself so that he could harvest organs from Matt later in time when El Patron's body fails. Matt is kept against his will, but he doesn't know it, because El Patron makes his life exactly comfortable enough that Matt is perfectly motivated to do what El Patron wants. He doesn't hate El Patron, because El Patron has successful propagandized him, brainwashing him from birth to agree with what he says. Matt must learn to hate his father for his evil in order to be the hero.

Explanation:

Other Questions
A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint? Find the value of c x 8 when c=9. Can someone find the mistakes and make the sentence plz.On both plz :( Which sentence uses parallel structure correctly?A) We plan on playing basketball and then to see a movie.B) She is not only a good cook but also she figure skates well.C) At the last performance, we were all feeling sad, relieved, and being somewhat nervous.D) Len's favorite pastimes are listening to music, going to baseball games, and hanging out with his friends. Put this in your own words, I'm writing a informational essay, will give brainiest.In addition, if there's someone encouraging another person, there being courageous. 19. The teaching of standards andexpectations of a particular culture iscalledA. discipline.B. guidance.C. limiting.D. constructing. In the first eight days after its release, how many Nintendo Wii systems were sold? Solve for xPLS HURRY