Please help WILL MARK BRAINLIST!!!!

Please Help WILL MARK BRAINLIST!!!!

Answers

Answer 1

Answer:

22

Step-by-step explanation:

2x+x-2=2x+9

3x-2=2x+9

x-2=9

x=11

MN=2x

MN=2(11)

MN=22


Related Questions

Here are yesterday's high temperatures (in Fahrenheit) in 12 U.S. cities.
48, 50, 54, 54, 62, 68, 70, 72, 75, 77, 78, 80
Notice that the temperatures are ordered from least to greatest.

Give the five-number summary and the interquartile range for the data set.

Answers

The five-number summary of the data set given is:

Minimum = 48First Quartile (Q1) = 54Median = 69Third Quartile (Q3) = 76Maximum = 80What is the five-number summary?

The five-number summary can be defined as a set of descriptive statistics that gives you an idea how your data looks like.

The five-number summary include the following:

Minimum, which is the lowest data value.First Quartile (Q1), which is the middle data value of the first half of the data set.Median, which is the middle data value of the data set.Third Quartile (Q3), which is the middle data value of the second half of the data set.Maximum, which is the lowest data value.

What is the Interquartile range?

The interquartile range is a measure of the spread of a data set, which is: IQR = Q3 - Q1

Given the data set, 48, 50, 54, 54, 62, 68, 70, 72, 75, 77, 78, 80:

Minimum = 48

First Quartile (Q1) = (54 + 54)/2 = 54

Median = (68 + 70)/2 = 69

Third Quartile (Q3) = (75 + 77)/2 = 76

Maximum = 80

Learn more about the five-number summary on:

https://brainly.com/question/24809873

(1 point for work, 1 point for correct answer) PLEASE HELP BEFORE WINTER BREAK​ NO LINKS HURRY

Answers

(9+17)/4=26/4=6.5
So 6.5 is the answer

What is the slope of the line that passes through the points (-5, -5 ?(−5,5)?

Answers

Answer:

undefined

Step-by-step explanation:

I'm assuming the points are (-5,-5) and (-5,5)

The formula to do slope is: (y2-y1)/x2-x1)

2 points: (x1, y1) (x2, y2)

So then:

(5-(-5))/(-5-(-5))=10/0

This shows that the line is vertical, which means that slope is undefined.

Answer:5/65/6

The slope of the line passing through the point (5,5) is 5/6.

Step-by-step explanation:



Find the value of y.

Answers

8 radical 3
There is a photo attached

Anna is working two summer jobs, making $18 per hour lifeguarding and making $11 per hour clearing tables. In a given week, she can work a maximum of 14 total hours and must earn at least $210. If Anna worked 12 hours clearing tables, determine the minimum number of whole hours lifeguarding that she must work to meet her requirements. If there are no possible solutions, submit an empty answer.

Answers

Answer: She would make $132 a day by cleaning tables for 12 hours and getting 11 per hour. She would have to get rid of 1 hour and 90 minutes of lifeguarding to get the same pay.

Step-by-step explanation:

What set of transformations could be applied to rectangle ABCD to create A″B″C″D″?

'Rectangle formed by ordered pairs A at negative 4, 2, B at negative 4, 1, C at negative 1, 1, D at negative 1, 2. The second rectangle is formed by ordered pairs A double prime at 2, negative 4, B double prime 1, negative 4, C double prime at 1, negative 1, D double prime at 2, negative 1.

A) Reflected over the x-axis and rotated 180°
B) Reflected over the y-axis and rotated 180°
C) Reflected over the x-axis and rotated 90° counterclockwise
D) Reflected over the y-axis and rotated 90° counterclockwise

Answers

Answer:

C) Reflected over the x-axis and rotated 90° counterclockwise

Step-by-step explanation:

Answer: Reflected over the x-axis and rotated 90° counterclockwise

Step-by-step explanation:

Took the test!

4(2v+6)=[?]v+[ ]

what is the questionmark

Answers

Answer: 8v+24

Step-by-step explanation:

[tex]4(2v+6)=4(2v)+4(6)=8v+24[/tex]

Which expression is equivalent to log Subscript 5 Baseline (StartFraction x Over 4 EndFraction) squared? 2 log Subscript 5 Baseline x log Subscript 5 Baseline 4 2 log Subscript 5 Baseline x log Subscript 5 Baseline 16 2 log Subscript 5 Baseline x 2 log Subscript 5 Baseline 4 2 log Subscript 5 Baseline x log Subscript 5 Baseline 4.

Answers

The required equivalent expression for  [tex]{log}_{5} \ (\frac{x}{4} ) ^{2}[/tex] is [tex]2 \ log_{5}\ x-2\ log_{5}\ 4[/tex].

Given expression,

[tex]{log}_{5} \ (\frac{x}{4} ) ^{2}[/tex].

We have to find the Equivalent fraction of  [tex]{log}_{5} \ (\frac{x}{4} ) ^{2}[/tex].

We know that from the properties of logarithm, the following identities

[tex]log\ m^{n} =n\ log\ m[/tex] .....(1)

[tex]log\ \frac{m}{n} = log\ m- log\ n\\[/tex].......(2)

Now, [tex]{log}_{5} \ (\frac{x}{4} ) ^{2}= 2 \ log_{5} \ \frac{x}{4}[/tex] ( using 1 identity)

Again using 2 identity, we get

[tex]{log}_{5} \ (\frac{x}{4} ) ^{2}= 2[ log_{5}\ x-log_{5}\ 4 ][/tex]. (using 2 identity)

[tex]{log}_{5} \ (\frac{x}{4} ) ^{2}= 2 \ log_{5}\ x-2\ log_{5}\ 4[/tex]

Hence the required equivalent expression for  [tex]{log}_{5} \ (\frac{x}{4} ) ^{2}[/tex] is [tex]{log}_{5} \ (\frac{x}{4} ) ^{2}= 2 \ log_{5}\ x-2\ log_{5}\ 4[/tex].

For more details on logarithm follow the link:

https://brainly.com/question/163125

Answer:

C on edge

Step-by-step explanation:

the graph of the function f is shown above. what is limx→2f(x)

Answers

The value of y as x tends to 2 is infinity since the curve progresses to infinity at this point that is [tex]\lim_{x \to 2} f(x) = \infty[/tex]

Find the graph attached. From the graph, we can see that the range of the function is the values along the y-axis and is from the minimum point on the curve (y = -2) to infinity

The range of the given graph in interval notation will be expressed as R = 2≤y<∞ or y ≥ 2.

Note that 2 is included since the circle on the value of 2 is shaded.

From the graph, we can deduce that the value of y as x tends to 2 is infinity since the curve progresses to infinity at this point.

Therefore we can conclude that [tex]\lim_{x \to 2} f(x) = \infty[/tex]

Learn more on the limits of a function here: https://brainly.com/question/23935467

Graph the following equation.
x+2y>-6

Answers

Answer:

im not to sure i think it is 45

Step-by-step explanation:

your welcome

Answer:

-2y=6-x

y=0.5x-3

x=0

y=0.5*0-3=-3

(0;-3)

y=0

0=0.5x-3

0.5x=3

x=3/0.5=6

(6;0)

Choose the true statements.
O
A linear function is expressed by a graph of a line that
crosses both axes at the origin. An equation is written in
slope-intercept form to express the same function as
shown in the graph. From just this information, what
statements can be made?
The slope of the equation must be positive.
The y-intercept of the equation is zero.
It is possible that the line on the graph is horizontal.
The slope of the equation must be negative.

Answers

Answer:

The y-intercept must be zero.

It is possible that the line is horizontal.

Step-by-step explanation:

The description states that the line "crosses both axes at the origin."  That would mean that the point (0,0) is on the graph.  The y-intercept is the value of y when x=0.  We see that it is zero in this case (0,0).  

The description says nothing about the slope.  So it could be either positive or negative.  But it could also mean that the slope is zero.  A zero slope would be a horizontal line.  So that is a second statement that is true:  "It is possible that the line on the graph is horizontal."

Answer:

its b and c

Step-by-step explanation:

Will mark brainly!! :)

Answers

Answer:

(2,1)

Step-by-step explanation:

The answer is (2,1)

please i need help finishing this last question or i might get in trouble.


Solve.

w−(−23)=1.06

Enter your answer as a fraction in simplest form in the box.

w =

Answers

59/150

How?

w= 59/150

59/150 and -2/3 have to have the same denominators.

So, what I did was, -2/3×50= -100/150.

(Process of a new equation)

59/150-(-100/150)

[The two - signs cross each other out, making it a + ]

59/150+100/150 <- New Equation

__________________________________

59/150+100/150= 159/150

159/150= 1 9/150

9÷150=0.06

1+0.06= 1.06

(PROOF ABOVE)

Answer

add 1.06 = 1 3/50  = 1 3/50 + (-2/3) =  59/150

Step-by-step explanation:

Write the equation of the line that passes through (0,5) and is perpendicular to the line x = 3.

Answers

Answer:

(0,5)x3=(15,5)

Step-by-step explanation:

what is the vertex of the porabola

Answers

Answer:

what is the vertex of the porabola by nagla 3by 7

what is what is sixth eighths times five(PLEASE HELP i'M STILL FAILING MATH!!!!!!!!!!!!!!!!!!!!)

Answers

Answer:

[tex]3\frac{3}{4}[/tex]

Step-by-step explanation:

[tex]\frac{6}{8} *\frac{5}{1}[/tex]

[tex]\frac{30}{8}[/tex] multiply across

[tex]\frac{15}{4}[/tex] simplify and convert into mixed number

[tex]3\frac{3}{4}[/tex]

ABC and XYZ are similar triangles with right angles at B and Y. AC=13 cm,
BC=5 cm. Find AB and XZ. (No links pls...)

Answers

Answer:

See below

Step-by-step explanation:

Since B is the right angle, AC is the opposite side - hypotenuse.

Use Pythagorean and find the missing side, AB:

[tex]AB = \sqrt{AC^2-BC^2} = \sqrt{13^2-5^2} =\sqrt{144} =12cm[/tex]

There is no info given to link the triangles ABC and XYZ and hence can't provide solution to any dimension of XYZ.

If the scale factor was given as k, then XZ would be:

XZ = k*BC = 5k

Who are the two children that clung to the Ghost of Christmas Present? What do they symbolize?

Answers

Answer:

Ignorance and Want

Step-by-step explanation:

Igorance and Want symbolizes the poor in the 19th century. PS: I hope this helps

Answer:

The boy is ignorance and the girl is want, in my opinion (you may have a different take on this) they symbolize the poor. Throughout the novella, we have seen the good side of the poor through the Cratchints who work hard day in day out, and now Dickens is wanting to show how malnourished the poor really is. It can also show how Dickens is saying that if the government doesn't act and help out the poor as well as everyone else, this is what the future for the poor will look like, malnourished and uneducated. It is showing us the consequences of being basically abandoned from society in general, abandoned by the education system, and again, I think that Dickens here is trying to show the consequences of the abandonment of the poor and how the government and the rich should change their ways to stop that from happening by being kind and charitable ect.

two angles of a triangle are 5x+20 and 2x+30 find the third angles​

Answers

Answer:

Third angle is [tex]130-7x[/tex]

Step-by-step explanation:

We have sum of angles is [tex]180^{0}[/tex]

Let the third angle be [tex]y[/tex]

Hence

[tex]5x+20+2x+30+y=180\\\\y=130-7x[/tex]

Third angle is [tex]130-7x[/tex]

Pls help trig question!!

Answers

[tex]4\sin^2 x - 3 = 3 \sin x\\\\\implies 4\sin^2 x -3 \sin x -3 =0\\\\\implies 4u^2 -3u -3 =0~~~~~~~~~~~~~~;[\text{Set} ~ \sin x = u]\\\\\implies u = \dfrac{-(-3) \pm \sqrt{(-3)^2 - 4\cdot 4 \cdot (-3)}}{2(4)}~~~~~~;[\text{Apply quadratic formula}]\\\\\\\implies u = \dfrac{3\pm\sqrt{57}}8\\\\\implies \sin x = \dfrac{3\pm\sqrt{57}}8~~~~~~;[\text{Substitute back}~ u = \sin x]\\\\\text{Now,}\\\\\sin x = \dfrac{3+\sqrt{57}}8\\\\\text{No solution for}~ x\in \mathbb{R} ~\text{Since}~ -1\leq \sin x \leq 1\\[/tex]

[tex]\sin x = \dfrac{3 - \sqrt{57}}8\\\\\implies x = n\pi + (-1)^n \sin^{-1} \left(\dfrac{3-\sqrt{57}}8\right)\\\\\\\text{ When n = 1,2 and}~ [0,2\pi]},\\\\\\x= \pi - \sin^{-1} \left(\dfrac{3-\sqrt{57}}8 \right)~ \text{and} ~x = 2\pi + \sin^{-1} \left(\dfrac{3-\sqrt{57}}8 \right)\\\\\text{In decimal,}\\\\x= 3.75~~~~ \text{and}~~~ x =5.68[/tex]

how do i solve use the GCF and the distributive property to express a sum as a product 52 +20+36

Answers

Answer: just add them all up add 50+20+36 then you get 106

Step-by-step explan

Write an equation for the perimeter of the rectangle

Answers

Answer:

Area = 2(5x - 4) + 2(5x)

Step-by-step explanation:

Perimeter is the sum of twice the width and twice the length of the rectangle. And since the question is asking us for an equation, we need to write, Area = 2(5x - 4) + 2(5x). When you are required to find the value of x with a given area, just plug that area into the equation, distribute, and simplify to get x.

2(5x)+ 2x(4+5)

You can say that!! What grade level is this

Write an equation of a line that is perpendicular to the given line and passes through the given point.
y = 6x - 7
(12,-4)
• y = 6x +5
• y = -6x-5
• y = -1/6 x + 6
•y = -1/6 - 2

Answers

Answer:

• y = -6x-5

Step-by-step explanation:

Find the number of hours worked from 7:34 A.M.
to 11:48 A.M., assuming pay is for full quarter-
hours.

Answers

Answer:

3 hours

Step-by-step explanation:

If pay is for full quarter hours, then the worker won't get paid for work intervals of less than 15 minutes.

Subtract 7:34 from 11:48:  we get 3:14 hours.  Because the 14 minutes is less than the 15 minutes of a full quarter hour, the worker won't get paid for those 14 minutes.  

So the 'number of hours worked' is 3 hours.

Note that 3:14 would be 3 hours 14 minutes.

f(x) = -3x +4 when x = -5 show every step

Answers

Answer:

f(-5) = 19

Step-by-step explanation:

f(x) = -3x + 4

f(-5) = -3(-5) + 4

f(-5) = 15 + 4

f(-5) = 19

Answer: The answer is 19

Step-by-step explanation: We know that the X value is -5 so we substitute that in for -3x to get (-3 x -5) We end up geting 15, next we add 4 and get 19. Basically the answer is 19. Have a great day.

Forgot to add the F(-5) sorry.

PLEASE HELP WILL MARK BRAINLIEST

Answers

Answer: (2, -15)

Step-by-step explanation:

Arianna and Aryanna went out to lunch over the weekend. They decided to eat at the cheesecake factory in ridge hill. their bill came out to 40$. if they wanted to leave a 20% tip for there waitress how much will the tip be

Answers

Answer:

Step-by-step explanation:

First we need to find 20% of their bill-$40.

So we write a proportion with fractions.

20/100 = x/40

Then we cross multiply. So 40 and 20 will get multiplied, and 100 and x will get multiplied. We will get this:

800 = 100x

Divide both sides by 100 to solve this.

Then we will get:

$8 = x  or  x = $8

Now that we know 20% of the bill this will also represent the tip. Our tip is $8.

Cube A has a volume of 9 in3. Cube B has a volume of 5 in3. Which of the following expresses the ratio of the side length of Cube A to the side length of Cube B?

(A) 3 : 5 ^1/3
(B) 5^1/3 : 3^1/3
(C) 3^1/3 : 5^2/3
(D) 3^1/3 : 5^1/3
(E) 3^2/3 : 5^1/3

Answers

Using the formula for the volume of a cube, it is found that the expression which gives the ratio of the side length of Cube A to the side length of Cube B is:

[tex]r = \frac{3^{\frac{2}{3}}}{5^{\frac{1}{3}}}[/tex]

Which means that option E is correct.

The volume of a cube of side length l is given by:

[tex]V = l^3[/tex]

For Cube A, the volume is of 9 cubic inches, hence:

[tex]l_a^3 = 9[/tex]

[tex]l_a = \sqrt[3]{9}[/tex]

[tex]l_a = 9^{\frac{1}{3}}[/tex]

[tex]l_a = 3^{\frac{2}{3}}[/tex]

For Cube B, the volume is of 5 cubic inches, hence:

[tex]l_b^3 = 5[/tex]

[tex]l_b = \sqrt[3]{5}[/tex]

[tex]l_b = 5^{\frac{1}{3}}[/tex]

Then, the ratio is:

[tex]r = \frac{l_a}{l_b} = \frac{3^{\frac{2}{3}}}{5^{\frac{1}{3}}}[/tex]

To learn more about the volume of a cube, you can take a look at https://brainly.com/question/13030328

(5) Arrange the decimals in decreasing order...
(a) 8.6, 0.86, 6.8
(b) 7.005, 5.07 7.05​

Answers

A) 0.86, 6.8, 8.6

B) 5.07, 7.005, 7.05

hope this is helpful!

(a) 8.6, 6.8, 0.86
(b) 7.05, 7.005, 5.07

A and B are complementary angles. If A = (x – 23)° and m
B = (2x + 29)°, then find the measure of B.

Answers

Answer:

∠ B = 85°

Step-by-step explanation:

Complementary angles sum to 90° , then

x - 23 + 2x + 29 = 90 , that is

3x + 6 = 90 ( subtract 6 from both sides )

3x = 84 ( divide both sides by 3 )

x = 28

Then

∠ B = 2x + 29 = 2(28) + 29 = 56 + 29 = 85°

Other Questions
EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg)