Answer:
1. Turdus Migratorius
2. Lithobates pipiens
3. Bubo Virginianus
4. Anas Plaatyrhynchos
5. Lepus
6. Archilochus Colubris
7. Thamnophis Sirtalis
8. Myotis Lucifugus
9. Phoca Vitulina
10. Macropus Rufus
Which relationship is an example of commensalim?
Please pleaseeee helppppp I’ll mark the brainliest!!!
Answer:
the first option is correct
Explanation:
Answer:
the lest one
Explanation: darwen belived
O research existing data on accidents involving cars
communicate the results by telling everyone about the prototype
Question 3 (1 point)
There is a set number of times you should go through the engineering design process
- if your design isn't working by the 3rd time through, it's time to just quit and give
up.
True
False
To
Answer:
false
Explanation:
you fix your design to make it work that is what being is all about if it doesn't work you don't give up you figure out what is wrong and fix it.
Bam hi cuts between what bases
explain the process of digestion abd absorption of carbohydrates.
Answer:
Carbohydrate digestion breaks down disaccharides (sugar) and complex carbohydrates into a simpler sugar so it can be absorbed. But not all are completely absorbed in the small intestines.
Explanation:
15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations
Answer:
C. Somatic
Explanation:
hope it helps ya :D
Using the data provided, how can we describe the difference between amplitude of an average wave in location B?
Compared to location A, an average wave in location B
A.
has more distance between it and the next wave.
B.
has less energy.
C.
is higher from the bottom to the top of the wave.
D.
has less distance between it and the next wave.
Answer:
has less distance between it and the next wave
an atom that has gained or lost one or more electrons
This is called an ion. :)
why would an athlete need to be concerned about a twitch or sustained contraction
Answer:
why an athlete would need to be concerned about twitches or contractions is because, whenever they perform, and such thing happens, it will most likely distract the athlete, and cause the athlete doing his/her performance to not be as good, and may lead to failure, for example, when someone is running very fast for a sprinting race, and he has a contraction in his leg it will cause him to react by showing signs of pain by slowing down or even tripping and falling, causing him to lose the race.
Hope this Helped!
Can someone pleeaseeee helpppp!! I’ll mark the brainliest
Answer:
i think its C im not sure but normally in my opinion that would be correct
Answer:
natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution
Explanation:
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
The purpose of mitosis includes all of the following EXCEPT
A)repair of tissue in an injury cause by a burn
B) formation of a sex cell
C)replacement of cells removed by skinned knee
D)lengthening the long bones of a child
What phase is mitosis in
Answer:
prophase, prometaphase, metaphase, anaphase, and telophase.
Explanation:
What is the net ATP gain at this stage of cellular respiration?
2
4
32
36
Answer:
The answer is A.) 2, Edge 2022
Explanation:
The net ATP gain at this stage of cellular respiration is 36. Therefore, option "D" is correct.
What is cellular respiration?A series of chemical reactions known as cellular respiration breaks down glucose into ATP, which can be used as energy to power numerous body processes. Cellular respiration has three main stages: the citric acid cycle, glycolysis, and oxidative phosphorylation.
In eukaryotes, the 4 phases of cell breath incorporate glycolysis, progress response (pyruvate oxidation), the Krebs cycle (otherwise called the citrus extract cycle), and oxidative phosphorylation through the electron transport chain.
Therefore, cellular respiration is the main process that generates ATP and gives energy to the body to work.
Learn more about cellular respiration, here:
https://brainly.com/question/29760658
#SPJ7
Sean and Catherine have 4 kids. Each kid has a different blood type. The public immediately assumes that Sean couldn't be the father. is this necessarily true? Use Punnett squares to show your work for if it is possible for them to have these 4 kids.
PLEASEEEE HELPPP!!!!!
As Sean and Catherine have four kids and each is different blood type. The public assumes Sean as father and Catherine as mother which is not necessary true.
The Puneet square is a helpful method to predict the variations and probability of cross-breeding. There could be possibly four changes such as blood group of Sean is A and Catherine is B then. Dominant blood group be found AA, AB, A an B blood group.Learn more about Catherine have 4 kids.
brainly.com/question/20757353.
What is relationship between genes dna and proteins
Answer:
genes are created by proteins. dna is created by genes
Explanation:
4.
What is the importance of biodiversity to humans and to ecosystems?
Answer:
Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.
Explanation:
looked it up
18. Viruses are considered
because they can not perform the characteristics of life without a
19. Viruses are made of two basic compounds,
and a
made of protein.
20. A virus infects a cell by injecting
into a cell.
Answer:
6. antibodies and DNA for the question no.6
When does gamete production occur?
Please help me on this question
How does sexual reproduction increase the variance of traits in a population?
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.
Answer:
B. Fewer pesticides are needed because of parasitoids.
Explanation:
Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation. Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.
A geneticist crossed pure breeding black mice with pure breeding brown mice. All the mice in the F1 generation had black coats. When these mice were crossed, they yielded 961 black coated mice and 317 brown coated mice.
Fill in the new combinations of alleles in the F2 generation.
Answer:
The correct answer is - the brown allele is not independent from the black allele and disappears in the F1 generation.
Explanation:
IN this question it is given that there is a cross between pure black and pure brown breed and the F1 generation has all-black coat offspring and their self cross produced 961 black and 317 brown.
The black coat offspring is three times than the brown coat offspring in F2 generation which means they have 3:1 ratio that comes in the self cross of heterozygous only there for the F1 generation black coat offspring have the heterozygous genotype for the trait,
Thus, the brown allele is not independent of the black allele and disappears in the F1 generation.
Select all that apply.
The first known pandemic in A.D. 542, struck which parts of the world?
Australia
Middle East
North America
South America
Asia
North Africa
Europe
PLEASE ANSWER CORRECTLY
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment. What relationship is shown here between the mistletoe and the tree?
A.Competition
B.Parasitism
C.Mutualism
D.Commensalism
Mistletoe extracts water and nutrients from the spruce, to the spruce tree's detriment. The relationship that is shown here between the mistletoe and the tree is Parasitism. Hence, the correct option is B.
What is Parasitism?Parasitism refers to a type of symbiotic relationship in which one organism benefits at the expense of the other organism, which is called host. The parasite lives on or inside the host and derive nutrients as well as shelter from the host, thereby providing no benefit to the host in return.
Examples of parasites includes tapeworms, roundworms, lice, fleas, and some species of bacteria and viruses.
Parasitism is a common for of symbiosis in nature and play an important role in shaping the relationships between species and maintaining balance in ecosystem. Hence, the correct option is B.
For more details regarding parasitism, visit:
https://brainly.com/question/29759870
#SPJ6
Select the group of organelles that is common to both plant cells and animal cells.
A.
cell wall, cell membrane, mitochondria
B.
cell membrane, mitochondria, cytoplasm
C.
cytoplasm, mitochondria, cell wall, nucleus
D.
nucleus, cytoplasm, chloroplasts
Answer:
B
Explanation:
Both cells have cell membranes, mitochondria ( they both do cellular respiration), and cytoplasm for structure
from his monohybrid crosses, Mendel developed his first law
Answer:
Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied
Explanation:
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation: