On a recent trip, Miles drove 58 miles the first hour,64 miles the second hour.and 62 miles the final hour. Estimate the average number of miles he drove each hour

Answers

Answer 1

Answer:

60

Step-by-step explanation:

all of those rounded to the nearest ten is 60


Related Questions

x2+2x+3 factorization

Answers

Answer:

Not possible

Step-by-step explanation:

Given quadratic polynomial = x² + 2x + 3.

Possible factors of 3 are , 1 & 3 .

And we can get 2 from 3 and 1 in only one way that is 3 - 1 .

=> x² + 2x + 3 .

=> x² + 3x - x + 3 .

=> x ( x + 3 ) - 1 ( x - 3 )

Hence the factorisation is not possible .

Please help me 20 points!!!!!

Answers

Answer:

A. 0.4 km

B. 48 fruits to 12 vegetables

C. 72 hours

60%

Step-by-step explanation:

1 km = 1000 m

You have 400 m

1000m/1km = 400m/1000m

400/1000

0.4km

4:1

Ok so an easy way to do this one is multiplication.

you need the number of fruits to be 4 times more than the number of vegetables.

A would be 2:1 because 16 is 2 times more than 8

B would be 4:1 because 48 is 4 times more than 12

C would be 8:1 because 24 is 8 times more than 3

D would be 3:1 because 60 is 3 times more than 20

B would be the correct answer

If they traveled 216 miles in 3 hours, to find average you have to divide miles by hours.

216/3

72 hours

The tigers won 12 of their last 20 games.

12/20

0.6

Percent is 100 times the decimal.

0.6*100

60%

Don't be afraid to reach out with any more questions! I hope this helps!

10. DESIGN Mr. Hagarty is choosing tiles to design a kitche backsplash for a rectangular area 65 inches wide and 9 in tall . Design a backsplash using each type of rhombi-shape tile that minimizes cost. a. diagonals of 1 inch and 1.5 inches, $0.05 each b. diagonals of 1.5 inches and 2 inches, $0.07 each Areas of Trapezoids, Rhombi, and Kites 2 © B O DO​

Answers

Answer:

I honeslty dont know I just need points to answer a question

Step-by-step explanation:

hope you find the answer youre looking for!

What is the value of −|−20| + |−8| ÷ |−4| − |6|?

Answers

The answer is -24. Hope this helps

Tim is clearing brush from a large piece of land. The table shows how many acres he has cleared over time. Tim clears the same amount of brush each day.
Complete the table to determine how many days it will take Tim to clear 1 acre and how many acres Tim will clear in 8 days.
Use the drop down menus to select your answers.

Answers

Answer:

first box is 3 and second is 2 2/3

which statement is true regarding the functions on the graph?

Answers

Answer:

f(3)=g(3)

Step-by-step explanation:

the only one i see is that

f(3)=g(3)

because the two functions intersect there

that means the two values are the same

2 mi = ____ ft Please help! :((

Answers

Answer:

2 mi = 10560 ft

Step-by-step explanation:

you coulve searched it up

Answer:

you multiply it by 2 so its 10560

Last year, Jeffrey grew 5/8 of an inch and his brother grew 1/2 of an inch. How much more
did Jeffrey grow than his brother?
Simplify your answer and write it as a fraction or as a whole or mixed number.

Answers

Answer:

Jeffrey grew 1/8 inch more than his brother

Step-by-step explanation:

5/8 - 1/2 = 5/8 - 4/8 = 1/8

Answer:

[tex]\frac{5}{4}[/tex] [tex]or[/tex] [tex]1.25[/tex]

Step-by-step explanation:

[tex]\frac{5}{8}[/tex] ÷ [tex]\frac{1}{2}[/tex] = [tex]?[/tex]

[tex]\frac{5}{8}[/tex] = [tex]0.625[/tex]

[tex]\frac{1}{2}[/tex] = [tex]0.5[/tex]

[tex]\frac{0.625}{0.5}[/tex] = [tex]\frac{5}{4}[/tex]

[tex]Therefore,[/tex] [tex]\frac{5}{4}[/tex] [tex]is[/tex] [tex]the[/tex] [tex]answer.[/tex]

Hope this helps! <3

Which diagram demonstrates the problem 3x 1/4

Answers

Answer:

A.

Step-by-step explanation:

3 * 1/4 = 3/4

Which answer shades 3 out of 4 blocks? A.

Answer:

the answer is A

Step-by-step explanation:

3 * (1/4) = .75.... Think about how many quarters make a dollar .75 cents is 3/4 of a dollar

write an equation of a line that is perpendicular to given line that passes through the given point 5y+2x=-15 T(5,-5)​

Answers

Step-by-step explanation:

The answer is on the bottom if you just wanna scroll down.

The first thing that you would want to do is turn the equation of the given line into slope-intercept form (it's just easier). To do that, you would want to isolate  y on either side. So subtract 2x and divide both sides by 5 and you get: y=-2/5x-3. After you do this, remember that perpendicular lines have the negative reciprical slope of the original line. So since the slope is -2/5, the slope of a perpendicular line would be 5/2. Now you have m=5/2 which is your slope! Now you can use slope point form which is y-y_1=m(x-x_1). You know your m which is 5/2. y-y_1=5/2(x-x_1). Since we know that the line passes through the point (5,-5) we can just plug the numbers in. y-(-5)=5/2(x-5). simplify everything: y+5=5/2(x-5). Remember, math is all about making things simple and easy. since the problem didn't say a specific type of equation, you can just put that as your answer!

Answer:

y+5=5/2(x-5)

Hope this helps! (If it's wrong, plz leave sum comments. thx lol)

Based only on the information given in the diagram, it is guaranteed that
AJKL ~ AWXY.
27°
A
63"
A. True
B. False

Answers

Answer:

True

Step-by-step explanation:

Given

In JKL, we have:

[tex]\angle J = 27[/tex]

[tex]\angle K = 90[/tex]

In WXY, we have:

[tex]\angle Y = 63[/tex]

[tex]\angle X = 90[/tex]

Required

Is JKL ~ WXY?

In both triangles, we already have one similar angle (90)

Next, is to determine the third angles in both triangles.

In JKL

[tex]\angle J + \angle K + \angle L = 180[/tex]

We have that:

[tex]\angle J = 27[/tex] and [tex]\angle K = 90[/tex]

The expression becomes:

[tex]27 + 90 + \angle L = 180[/tex]

[tex]117 + \angle L = 180[/tex]

[tex]\angle L = 180-117[/tex]

[tex]\angle L = 63[/tex]

In WXY

[tex]\angle W + \angle X + \angle Y = 180[/tex]

We have that:

[tex]\angle Y = 63[/tex] and [tex]\angle X = 90[/tex]

The expression becomes:

[tex]\angle W + 63 + 90 = 180[/tex]

[tex]\angle W + 153 = 180[/tex]

[tex]\angle W = 180-153[/tex]

[tex]\angle W = 27[/tex]

The three angles in JKL are:

[tex]\angle J = 27[/tex]    [tex]\angle K = 90[/tex]   [tex]\angle L = 63[/tex]

The three angles in WXY are:

[tex]\angle W = 27[/tex]   [tex]\angle X = 90[/tex]   [tex]\angle Y = 63[/tex]

By comparing the angles, we can conclude that  both triangles are similar because of AAA postulate (Angle-Angle-Angle)

plz help !!!!! complete the function tables then graph

Answers

Answer:

Step-by-step explanation:

How many 2-inch cubes are needed to completely fill a cubic box that measure 8 inches.

Answers

Answer:

It will be 64 cubes.

Step-by-step explanation:

if one side is 8 inches then 8/2 is 4

to fill one face, 4 × 4 = 16

to fill a cube 16 × 4 = 64

Answer: 64 cubes will fit

Yupjyyhttgtgthyuygrcgtchty

25 points question is below

Answers

Answer:

x - 5y = 30

Step-by-step explanation:

If you subtract x from both equations, you'll get -x. If you divide -5y, you'll end up with 1/5x and 6. The intercept doesn't matter but the slopes are parallel which means they'll never intersect anyway

good answer also makes a lot of sense you are correct

I don’t know the answer

Answers

I believe the answer would be yes. Since your dealing with Ratios it would be simple to understand that they are proportional. I'll explain a little better.

This means that if you double this ratio, it will still be equivalent to 1:3

1:3

This is also proportional because this number will always be equivalent to itself.

7:21

-----------------------------------------------------------------------------------------------------------------Hope this helps

-Miri

A car is traveling at a rate of 48 miles per hour. If the car continues to travel at this same rate, how many hours will it take the car to travel 612 miles?

Answers

Answer:

12.75

Step-by-step explanation:

If you make a proportion: 48/1=612/x

1(612)= 612

612/48

12.75 hours

At a speed of 48 miles per hour, the car will take approximately 12.75 hours to go 612 miles.

What is the distance?

A mathematical number known as distance measures "how much ground an object has traveled" while moving. Distance is defined as the product of speed and time.

A car is traveling at a rate of 48 miles per hour.

To determine the number of hours it will take the car to travel 612 miles at a rate of 48 miles per hour, you can divide the distance traveled by the rate at which the car is traveling:

⇒ distance ÷ rate

⇒ 612 miles / 48 miles/hour

Apply the division operation, and we get

⇒ 12.75 hours

Therefore, it will take the car about 12.75 hours to travel 612 miles at a rate of 48 miles per hour.

Learn more about the distance here:

brainly.com/question/13269893

#SPJ2

Is each graph a function or not?

Answers

Answer:

IN THIS ORDER

NO

NO

YES

YES

NO

YES

Step-by-step explanation:

Hope this helped if I got it wrong, sorry ill edit it if I did :)

What is the temperature if it is 9° colder than 15 F

Answers

Answer:

24 Degrees Farinhieght.

Step-by-step explanation:

15 degrees farinhieght added to 9 is 24 degrees.

in a box of sweets 7/10 of the sweets are red the rest are purple. what is the ratio of red sweets?

Answers

Answer:7:3

Step-by-step explanation:

F(x)=x/2 +8, what is f(x) when x = 10?
4
ОООО
13
36

Answers

Answer:

13

Step-by-step explanation:

Just replace x with 10, so F(10) = 10/2 + 8. Which is 5 + 8.

Factor x3 + 2x2 + x completely.

Answers

Answer:

[tex] {x}^{3} + 2 {x}^{2} + x[/tex]

[tex]x(x {}^{2} + 2x + 1)[/tex]

[tex]x(x + 1) {}(x + 1)[/tex]

[tex]x(x + 1) {}^{2} [/tex]

Answer:

C. x(x+1)2 on edu 2021

Step-by-step explanation:

Find the original price of a pair of shoes if the sale price is $63 after a 30% discount.

Answers

Answer:

$90

Step-by-step explanation:

To find the original price, divide 63 by 0.7:

63/0.7

= 90

So, the original price is $90

Answer:

$90.00

Step-by-step explanation:

First of all let x be the price of the pair of shoes that you are trying to find.

next since we have 30percent off that price we have

x - 0.30x = 0.70x

which in turn is equal to 63 dollars

so our expression is

0.70x = $63

x = 63 / 0.70

= $ 90.00

What is the equation of the line that has a slope of -3 and passes through the point (-2, 4)?
O y = -3x - 2
y=-3x
ООО
y=-3x - 4
y = -3x + 4
O y=-3x + 2

Answers

Y = -3x + b
Plug in points
4 = -3(-2) + b
4 = 6 + b, b = -2
Solution: y = -3x - 2

Which symbol will make the number sentence true?

Answers

Answer:

<

Step-by-step explanation:

8/11=0.72727272727272727272727272 just repeated over and over again so its less

Answer:

b

Step-by-step explanation:

how do i right the half of x pls help will give brainliesst answer

Answers

Answer:[tex]\frac{1}{2}[/tex]x or x/2

Step-by-step explanation:

f(x) = x2. What is g(x)?

Answers

A because:

1/4 * 2^2 = 1/4 * 4 = 1

Point (2, 1)

a line passes through the points (1, 4) and (3, –4). which is the slope of the line?

Answers

stupid thin wont load

WHATS THE ANSWER HELP

Answers

The answer to that problem is (3, 1)

ANSWER ASAP ITS FOR FINALS
Name Geometry B Final ID: 1 Date Period Name the relationship: complementary, linear pair, vertical, adjacent, alternate interior, corresponding, or alternate exterior, 1) 2) the 3) 4) # Find the measure of angle b 6) 5)​

Answers

Answer:

9. 66°

10. 44°

11. [tex]2\sqrt{7}[/tex]

12. [tex]2\sqrt{3}[/tex]

13. 27.3

14. 33.9

15. 22°

16. 24°

Step-by-step explanation:

9. Add 120 + 80 (equals 200) and subtract that from 360 (Because all angles in a quadrilteral add to 360°), this equals 160. Plug the same number in for both variables in the two other angle equations until the two angles add to 160. For shown work on #9, write:

120 + 80 = 200

360 - 200 = 160

12(5) + 6 = 66°

19(5) - 1 = 94°

94 + 66 = 160

10. Because the two sides are marked as congruent, the two angles are as well. This means the unlabeled angle is also 68°. The interior angles of a triangle always add to 180°, so add 68+68 (equals 136) and subtract that from 180, this equals 44. For shown work on #10, write:

68 x 2 = 136

180 - 136 = 44

11. Use the Pythagorean theorem (a² + b² = c²) (Make sure to plug in the hypotenuse for c). Solve the equation. For shown work on #10, write:

a² + b² = c²

a² + 6² = 8²

a² + 36 = 64

a² = 28

a = [tex]\sqrt{28}[/tex]

a = [tex]2\sqrt{7}[/tex]

12. (Same steps as #11) Use the Pythagorean theorem (a² + b² = c²) (Make sure to plug in the hypotenuse for c). Solve the equation. For shown work on #11, write:

a² + b² = c²

a² + 2² = 4²

a² + 4 = 16

a² = 12

a = [tex]\sqrt{12}[/tex]

a = [tex]2\sqrt{3}[/tex]

13. Use SOH CAH TOA and solve with a scientific calculator. For shown work on #13, write:

Sin(47°) = [tex]\frac{20}{x}[/tex]

x = 27.3

14. Use SOH CAH TOA and solve with a scientific calculator. For shown work on #14, write:

Tan(62°) = [tex]\frac{x}{18}[/tex]

x = 33.9

15. Use SOH CAH TOA and solve with a scientific calculator. For shown work on #15, write:

cos(θ) = 52/56

θ = cos^-1 (0.93)

θ = 22°

16. (Same steps as #15) Use SOH CAH TOA and solve with a scientific calculator. For shown work on #16, write:

sin(θ) = 4/10

θ = sin^-1 (0.4)

θ = 24°

Good luck!!

Find the slope of the line represented by the table

Answers

Answer:

slope = 3

Step-by-step explanation:

Calculate the slope m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (3, 8) and (x₂, y₂ ) = (1, 2) ← 2 ordered pairs from the table

m = [tex]\frac{2-8}{1-3}[/tex] = [tex]\frac{-6}{-2}[/tex] = 3

Other Questions
Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False Right answer will get brainlist pleasee help choose the correct one Which best describes the scene that is described in Countee Cullens Tableau?A. Two children are running away from homeB. A man is remembering his grandfathers table C. A black boy and white boy are walking together as friends D.A black boy and a white body get into a fight on the street . example of secondary analysis Starch is a _____. jhcgrwzxcvhbnkjm What events transpired (occurred) in France from 1795-1815?I Choose the answer that is most descriptive of the Solar System. Sun, planets, moons, asteroids, comets Nebulas, star clusters, super nova, black holes, binary stars Jupiter, Neptune, Saturn, Uranus, dwarf planets Jupiter, Great Red Spot, 8 regular moons, 58 irregular moons Which line best expresses the main message of the poem?aWhen yellow leaves, or none, or few, do hangbDeaths second self, that seals up all in rest.cTo love that well, which thou must leave ere long.dIn me thou seest the glowing of such fire Representing Relationships and Functionspls i need help